Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-450a-5p URS00003E5ECC_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (RefSeq, MirGeneDB, MalaCards, ENA, LncBase, TarBase, miRBase, GeneCards). Described in 22 papers. Homo sapiens (human) hsa-miR-450a-5p sequence is a product of miR-450a-5p, miR-450a, miR-450, MIR450A2, hsa-miR-450a, hsa-miR-450a-5p, HSA-MIR-RG-52, MIR450A1, MIR-RG-52 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 3-10C, ACF1, ACTB, AD1, AHDC1, AHNAK, AMCF-I, AMOTL1, AMOTL2, ANC-2H01.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUUUGCGAUGUGUUCCUAAUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 17 other species

    1. Bos taurus bta-miR-450a
    2. Callithrix jacchus cja-miR-450b
    3. Canis lupus familiaris Cfa-Mir-450-P1_5p (mature (guide))
    4. Cavia porcellus (domestic guinea pig) cpo-miR-450a-5p
    5. Cervus elaphus (red deer) cel-miR-450
    6. Cricetulus griseus cgr-miR-450a
    7. Dasypus novemcinctus dno-miR-450a-5p
    8. Eptesicus fuscus efu-miR-450
    9. Equus caballus (horse) eca-miR-450a
    10. Macaca mulatta (Rhesus monkey) mml-miR-450a-5p
    11. Mus musculus (house mouse) mmu-miR-450a-5p
    12. Nomascus leucogenys nle-miR-450a
    13. Oryctolagus cuniculus ocu-miR-450a-5p
    14. Pan paniscus ppa-miR-450a
    15. Pan troglodytes (chimpanzee) ptr-miR-450a
    16. Pteropus alecto (black flying fox) pal-miR-450a-5p
    17. Sus scrofa (pig) ssc-miR-450a
    18. Tupaia chinensis (Chinese tree shrew) tch-miR-450a-5p