Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) Cfa-Mir-154-P30_3p (mature (guide)) URS00003E5E03_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGACACAUGGUCUACUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus bta-miR-1197
  2. Capra hircus (goat) chi-miR-1197-3p
  3. Cavia porcellus cpo-miR-1197-3p
  4. Dasypus novemcinctus dno-miR-1197-3p
  5. Echinops telfairi Ete-Mir-154-P30_3p (mature (guide))
  6. Equus caballus (horse) eca-miR-1197
  7. Homo sapiens hsa-miR-1197
  8. Macaca mulatta Mml-Mir-154-P30_3p (mature (guide))
  9. Mus musculus (house mouse) mmu-miR-1197-3p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-1197-3p
  11. Ovis aries oar-miR-1197-3p
  12. Pan troglodytes ptr-miR-1197
  13. Pongo pygmaeus ppy-miR-1197
  14. Rattus norvegicus Rno-Mir-154-P30_3p (mature (guide))