Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 9) secondary structure diagram

Saccharomyces cerevisiae S288C tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 9) URS00003E41F6_559292

Automated summary: This tRNA sequence is 72 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 2 databases (GtRNAdb, ENA). Described in 11 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 9) sequence is a product of tRNA-Pro-TGG-1-9, SUF9, tRNA-Pro-TGG-1-5, SUF8, tRNA-Pro-TGG-1-7, SUF11, tRNA-Pro-TGG-1-3, TRN1, tRNA-Pro-TGG-1-1, tRNA-Pro-TGG-1-4, SUF7, tRNA-Pro-TGG-1-2, tRNA-Pro-TGG-1-8, tRNA-Pro-TGG-1-6 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGGCGUGUGGUCUAGUGGUAUGAUUCUCGCUUUGGGUGCGAGAGGCCCUGGGUUCAAUUCCCAGCUCGCCCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 170 other species

    1. [Candida] glabrata tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 7)
    2. Clavispora lusitaniae ATCC 42720 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 4)
    3. Clavispora lusitaniae tRNA-Pro
    4. Debaryomyces hansenii CBS767 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 7)
    5. Drosophila simulans tRNA-Pro
    6. Eremothecium cymbalariae DBVPG#7215 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 5)
    7. Eremothecium sinecaudum tRNA-Pro
    8. Kazachstania africana CBS 2517 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 9)
    9. Kluyveromyces lactis tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 7)
    10. Kluyveromyces marxianus tRNA-Pro
    11. Kluyveromyces marxianus var. marxianus KCTC 17555 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 7)
    12. Komagataella pastoris tRNA-Pro
    13. Komagataella phaffii CBS 7435 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 4)
    14. Komagataella phaffii GS115 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 4)
    15. Komagataella phaffii tRNA-Pro
    16. Lachancea dasiensis tRNA-Pro (TGG) cove score=59.02
    17. Lachancea dasiensis tRNA-Pro (TGG) cove score=59.53
    18. Lachancea fermentati tRNA-Pro (TGG) cove score=56.84
    19. Lachancea kluyveri NRRL Y-12651 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    20. Lachancea lanzarotensis tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 6)
    21. Lachancea meyersii CBS 8951 tRNA-Pro (TGG) cove score=60.30
    22. Lachancea mirantina tRNA-Pro (TGG) cove score=60.25
    23. Lachancea nothofagi CBS 11611 tRNA-Pro (TGG) cove score=57.83
    24. Lachancea quebecensis transfer RNA
    25. Lachancea sp. CBS 6924 tRNA-Pro (TGG) cove score=58.51
    26. Lachancea thermotolerans CBS 6340 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 6)
    27. Lentilactobacillus parakefiri tRNA-Pro
    28. Millerozyma farinosa CBS 7064 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 6)
    29. Saccharomyces arboricola H-6 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    30. Saccharomyces boulardii (nom. inval.) tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 9)
    31. Saccharomyces cerevisiae AWRI796 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    32. Saccharomyces cerevisiae tRNA-Pro
    33. Saccharomyces cerevisiae CBS 7960 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 9)
    34. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 8)
    35. Saccharomyces cerevisiae CLIB215 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    36. Saccharomyces cerevisiae CLIB324 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    37. Saccharomyces cerevisiae CLIB382 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 5)
    38. Saccharomyces cerevisiae EC1118 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 9)
    39. Saccharomyces cerevisiae EC9-8 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 9)
    40. Saccharomyces cerevisiae FL100 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 13)
    41. Saccharomyces cerevisiae FostersB tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    42. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    43. Saccharomyces cerevisiae Lalvin QA23 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    44. Saccharomyces cerevisiae P283 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    45. Saccharomyces cerevisiae P301 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 8)
    46. Saccharomyces cerevisiae PE-2 tRNA-Pro
    47. Saccharomyces cerevisiae PW5 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 9)
    48. Saccharomyces cerevisiae R008 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    49. Saccharomyces cerevisiae R103 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    50. Saccharomyces cerevisiae RM11-1a tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    51. Saccharomyces cerevisiae Sigma1278b tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    52. Saccharomyces cerevisiae T73 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 7)
    53. Saccharomyces cerevisiae T7 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    54. Saccharomyces cerevisiae UC5 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 7)
    55. Saccharomyces cerevisiae UFMG A-905 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 9)
    56. Saccharomyces cerevisiae Vin13 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    57. Saccharomyces cerevisiae VL3 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    58. Saccharomyces cerevisiae W303 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 9)
    59. Saccharomyces cerevisiae Y10 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    60. Saccharomyces cerevisiae YJM1078 tRNA-Pro
    61. Saccharomyces cerevisiae YJM1083 tRNA-Pro
    62. Saccharomyces cerevisiae YJM1129 tRNA-Pro
    63. Saccharomyces cerevisiae YJM1133 tRNA-Pro
    64. Saccharomyces cerevisiae YJM1190 tRNA-Pro
    65. Saccharomyces cerevisiae YJM1199 tRNA-Pro
    66. Saccharomyces cerevisiae YJM1202 tRNA-Pro
    67. Saccharomyces cerevisiae YJM1208 tRNA-Pro
    68. Saccharomyces cerevisiae YJM1242 tRNA-Pro
    69. Saccharomyces cerevisiae YJM1244 tRNA-Pro
    70. Saccharomyces cerevisiae YJM1248 tRNA-Pro
    71. Saccharomyces cerevisiae YJM1250 tRNA-Pro
    72. Saccharomyces cerevisiae YJM1252 tRNA-Pro
    73. Saccharomyces cerevisiae YJM1273 tRNA-Pro
    74. Saccharomyces cerevisiae YJM1304 tRNA-Pro
    75. Saccharomyces cerevisiae YJM1307 tRNA-Pro
    76. Saccharomyces cerevisiae YJM1311 tRNA-Pro
    77. Saccharomyces cerevisiae YJM1326 tRNA-Pro
    78. Saccharomyces cerevisiae YJM1332 tRNA-Pro
    79. Saccharomyces cerevisiae YJM1336 tRNA-Pro
    80. Saccharomyces cerevisiae YJM1338 tRNA-Pro
    81. Saccharomyces cerevisiae YJM1341 tRNA-Pro
    82. Saccharomyces cerevisiae YJM1342 tRNA-Pro
    83. Saccharomyces cerevisiae YJM1355 tRNA-Pro
    84. Saccharomyces cerevisiae YJM1356 tRNA-Pro
    85. Saccharomyces cerevisiae YJM1381 tRNA-Pro
    86. Saccharomyces cerevisiae YJM1383 tRNA-Pro
    87. Saccharomyces cerevisiae YJM1385 tRNA-Pro
    88. Saccharomyces cerevisiae YJM1386 tRNA-Pro
    89. Saccharomyces cerevisiae YJM1387 tRNA-Pro
    90. Saccharomyces cerevisiae YJM1388 tRNA-Pro
    91. Saccharomyces cerevisiae YJM1389 tRNA-Pro
    92. Saccharomyces cerevisiae YJM1399 tRNA-Pro
    93. Saccharomyces cerevisiae YJM1400 tRNA-Pro
    94. Saccharomyces cerevisiae YJM1401 tRNA-Pro
    95. Saccharomyces cerevisiae YJM1402 tRNA-Pro
    96. Saccharomyces cerevisiae YJM1415 tRNA-Pro
    97. Saccharomyces cerevisiae YJM1417 tRNA-Pro
    98. Saccharomyces cerevisiae YJM1418 tRNA-Pro
    99. Saccharomyces cerevisiae YJM1419 tRNA-Pro
    100. Saccharomyces cerevisiae YJM1433 tRNA-Pro
    101. Saccharomyces cerevisiae YJM1434 tRNA-Pro
    102. Saccharomyces cerevisiae YJM1439 tRNA-Pro
    103. Saccharomyces cerevisiae YJM1443 tRNA-Pro
    104. Saccharomyces cerevisiae YJM1444 tRNA-Pro
    105. Saccharomyces cerevisiae YJM1447 tRNA-Pro
    106. Saccharomyces cerevisiae YJM1450 tRNA-Pro
    107. Saccharomyces cerevisiae YJM1460 tRNA-Pro
    108. Saccharomyces cerevisiae YJM1463 tRNA-Pro
    109. Saccharomyces cerevisiae YJM1477 tRNA-Pro
    110. Saccharomyces cerevisiae YJM1478 tRNA-Pro
    111. Saccharomyces cerevisiae YJM1479 tRNA-Pro
    112. Saccharomyces cerevisiae YJM1526 tRNA-Pro
    113. Saccharomyces cerevisiae YJM1527 tRNA-Pro
    114. Saccharomyces cerevisiae YJM1549 tRNA-Pro
    115. Saccharomyces cerevisiae YJM1573 tRNA-Pro
    116. Saccharomyces cerevisiae YJM1574 tRNA-Pro
    117. Saccharomyces cerevisiae YJM1592 tRNA-Pro
    118. Saccharomyces cerevisiae YJM1615 tRNA-Pro
    119. Saccharomyces cerevisiae YJM189 tRNA-Pro
    120. Saccharomyces cerevisiae YJM193 tRNA-Pro
    121. Saccharomyces cerevisiae YJM195 tRNA-Pro
    122. Saccharomyces cerevisiae YJM244 tRNA-Pro
    123. Saccharomyces cerevisiae YJM248 tRNA-Pro
    124. Saccharomyces cerevisiae YJM269 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 11)
    125. Saccharomyces cerevisiae YJM270 tRNA-Pro
    126. Saccharomyces cerevisiae YJM271 tRNA-Pro
    127. Saccharomyces cerevisiae YJM320 tRNA-Pro
    128. Saccharomyces cerevisiae YJM326 tRNA-Pro
    129. Saccharomyces cerevisiae YJM428 tRNA-Pro
    130. Saccharomyces cerevisiae YJM450 tRNA-Pro
    131. Saccharomyces cerevisiae YJM451 tRNA-Pro
    132. Saccharomyces cerevisiae YJM453 tRNA-Pro
    133. Saccharomyces cerevisiae YJM456 tRNA-Pro
    134. Saccharomyces cerevisiae YJM470 tRNA-Pro
    135. Saccharomyces cerevisiae YJM541 tRNA-Pro
    136. Saccharomyces cerevisiae YJM554 tRNA-Pro
    137. Saccharomyces cerevisiae YJM555 tRNA-Pro
    138. Saccharomyces cerevisiae YJM627 tRNA-Pro
    139. Saccharomyces cerevisiae YJM681 tRNA-Pro
    140. Saccharomyces cerevisiae YJM682 tRNA-Pro
    141. Saccharomyces cerevisiae YJM683 tRNA-Pro
    142. Saccharomyces cerevisiae YJM689 tRNA-Pro
    143. Saccharomyces cerevisiae YJM693 tRNA-Pro
    144. Saccharomyces cerevisiae YJM969 tRNA-Pro
    145. Saccharomyces cerevisiae YJM972 tRNA-Pro
    146. Saccharomyces cerevisiae YJM975 tRNA-Pro
    147. Saccharomyces cerevisiae YJM978 tRNA-Pro
    148. Saccharomyces cerevisiae YJM981 tRNA-Pro
    149. Saccharomyces cerevisiae YJM984 tRNA-Pro
    150. Saccharomyces cerevisiae YJM987 tRNA-Pro
    151. Saccharomyces cerevisiae YJM990 tRNA-Pro
    152. Saccharomyces cerevisiae YJM993 tRNA-Pro
    153. Saccharomyces cerevisiae YJM996 tRNA-Pro
    154. Saccharomyces cerevisiae YJSH1 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 10)
    155. Saccharomyces kudriavzevii FM1056 tRNA-Pro (TGG) (tRNA-Pro-TGG-1-1)
    156. Saccharomyces kudriavzevii FM1072 tRNA-Pro (TGG) (tRNA-Pro-TGG-1-1)
    157. Saccharomyces kudriavzevii FM1076 tRNA-Pro (TGG) (tRNA-Pro-TGG-1-1)
    158. Saccharomyces kudriavzevii IFO10990 tRNA-Pro (TGG) (tRNA-Pro-TGG-1-1, tRNA-Pro-TGG-1-2)
    159. Saccharomyces kudriavzevii IFO10991 tRNA-Pro (TGG) (tRNA-Pro-TGG-1-1)
    160. Saccharomyces kudriavzevii IFO 1802 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 11)
    161. Saccharomyces kudriavzevii ZP591 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 5)
    162. Scheffersomyces stipitis CBS 6054 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 6)
    163. Spathaspora arborariae UFMG-19.1A tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 6)
    164. Tetrapisispora blattae CBS 6284 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 11)
    165. Tetrapisispora phaffii CBS 4417 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 6)
    166. Torulaspora delbrueckii tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 6)
    167. Vanderwaltozyma polyspora DSM 70294 tRNA-Pro (TGG) (tRNA-Pro-TGG-1 1 to 8)
    2D structure New