Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) microRNA dme-mir-318 precursor secondary structure diagram

Drosophila melanogaster (fruit fly) microRNA dme-mir-318 precursor URS00003E3F19_7227

Automated summary: This pre miRNA sequence is 68 nucleotides long and is found in Drosophila melanogaster. Annotated by 5 databases (FlyBase, ENA, Rfam, miRBase, RefSeq). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-318, RF00818). Drosophila melanogaster (fruit fly) microRNA dme-mir-318 precursor sequence is a product of FBgn0262420, mir-318 precursor, mir-318 precursor RNA, 318 precursor RN, 318 precursor RNA, dme-mir-318 precursor, 318, mir-318, mir-318 precurso genes. Found in the fruit fly reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUUAUGGGAUACACACAGUUCAGUUUUGUCACACUUCAAGCAUCACUGGGCUUUGUUUAUCUCAUGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 2 other species

    1. Drosophila erecta microRNA der-mir-318 precursor
    2. Drosophila sechellia microRNA dse-mir-318 precursor
    2D structure Publications New