Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1237-5p URS00003E1F0B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1237: Hsa-mir-1237 is a miRNA that has been found to have a binding site in all brain tissues examined [PMC4028873]. It is one of the four miRNAs, along with hsa-miR-1978, hsa-miR-933, and hsa-miR-889, that were not previously reported to have roles in ovarian cancer [PMC8148489]. However, further analysis revealed that hsa-mir-1237, along with hsa-miR-933 and hsa-miR-889, were significantly associated with overall survival in patients with ovarian cancer [PMC8148489]. In a study on CACO-2 cells and CW-2 cells, the expression levels of hsa-mir-1237 were found to be significantly changed after treatment with Gal-9 [PMC8072828]. Hsa-mir-1237 was also commonly altered in CACO-2 cells and CW-2 cells both in vitro and in vivo [PMC8072828]. Additionally, it was identified as a miRNA of mirtron origin processed from intron 11 of the RPS6KA4 gene [PMC5932543]. PsRNA-seq was used as a highly sensitive technique to detect low amounts of mature miRNAs like has-miR21 star and hsa-mir1237 [PMC5932543].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGGGGCGGGGCCGAAGCGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications