Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-1298 URS00003DF3AE_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-1298: TET1 and a long non-coding RNA (lncRNA) called MSTRG.119672 in bovine placenta have been found to be regulated by bta-mir-1298 [PMC6934727]. Several tissue-specific microRNAs have been identified in different organs of cattle, including rumen-specific miRNAs, liver-specific miRNAs, and mammary gland-specific miRNAs [PMC6371894]. A total of 182 differentially expressed genes (DEGs) are regulated by 13 differentially expressed miRNAs, including bta-mir-1298 [PMC7911131]. Additionally, circRNA_03706 and circRNA_02728 have been found to have regulatory relationships with bta-mir-1298 [PMC8946036]. The expression levels of bta-mir-1298 have been observed to increase with antler growth in cattle [PMC9957509]. Finally, bta-mir-1298, bta-miR-486, and a novel miR-166 have been retained for verification via stem-loop RT-qPCR [PMC9957509].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAUUCGGCUGUCCAGAUGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Canis lupus familiaris (dog) Cfa-Mir-1298_5p (mature (guide))
  2. Cervus elaphus (red deer) Cel-miR-1298
  3. Equus caballus eca-miR-1298
  4. Homo sapiens (human) hsa-miR-1298-5p
  5. Macaca mulatta mml-miR-1298-5p
  6. Mus musculus (house mouse) mmu-miR-1298-5p
  7. Oryctolagus cuniculus ocu-miR-1298-5p
  8. Pan troglodytes ptr-miR-1298
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-1298
  10. Rattus norvegicus (Norway rat) rno-miR-1298
Publications