Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-1298 URS00003DF3AE_9796

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAUUCGGCUGUCCAGAUGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus bta-miR-1298
  2. Canis lupus familiaris (dog) Cfa-Mir-1298_5p (mature (guide))
  3. Cervus elaphus (red deer) Cel-miR-1298
  4. Homo sapiens (human) hsa-miR-1298-5p
  5. Macaca mulatta mml-miR-1298-5p
  6. Mus musculus (house mouse) mmu-miR-1298-5p
  7. Oryctolagus cuniculus ocu-miR-1298-5p
  8. Pan troglodytes ptr-miR-1298
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-1298
  10. Rattus norvegicus (Norway rat) rno-miR-1298
Publications