Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-1298 URS00003DF3AE_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-1298: miR-1298 is a novel miRNA that inhibits the growth of KRAS-driven cancer cells both in vitro and in vivo [27]. It is down-regulated in gastric cancer tissues and cells, and its over-expression inhibits cell proliferation and invasion [15]. Lower miR-1298 expression levels are associated with lymph node metastasis, TNM stage, and predict poor disease-free survival (DFS) and overall survival (OS) of patients with gastric cancer [15]. It is also down-regulated in neuroglioma [14]. In rat glioma C6 cells, rno-mir-1298 is significantly down-regulated, and its over-expression inhibits proliferation and induces apoptosis [28]. In glioblastoma tissues, miR-1298-5p is decreased, and its over-expression inhibits proliferation, migration, invasion, and induces apoptosis of glioma cells [PMC7367721]. B4galt1 is a target gene of rno-mir-1298 that is negatively regulated by it [PMC9482859]. Rno-mir-1298 expression levels are significantly decreased following DMED (diabetic microvascular endothelial dysfunction) but upregulated with MSCs (mesenchymal stem cells) treatment [PMC9482859]. Rno-mir-1298 expression levels are also significantly downregulated in ischemia-reperfusion models of rat tumor C6 cells but upregulated after apelin-13 reperfusion treatment [PMC5879898].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAUUCGGCUGUCCAGAUGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus bta-miR-1298
  2. Canis lupus familiaris (dog) Cfa-Mir-1298_5p (mature (guide))
  3. Cervus elaphus (red deer) Cel-miR-1298
  4. Equus caballus eca-miR-1298
  5. Homo sapiens (human) hsa-miR-1298-5p
  6. Macaca mulatta mml-miR-1298-5p
  7. Mus musculus (house mouse) mmu-miR-1298-5p
  8. Oryctolagus cuniculus ocu-miR-1298-5p
  9. Pan troglodytes ptr-miR-1298
  10. Pongo pygmaeus (Bornean orangutan) ppy-miR-1298
Publications