Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1298-5p URS00003DF3AE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1298: Hsa-mir-1298 is a microRNA gene located on the X chromosome (Xq23) and is 112 bases in length [PMC8006078]. It has been predicted to target DROSHA by the Patrocles and TargetScan prediction algorithms [PMC4229095]. However, a single nucleotide polymorphism (SNP) called rs10719 in the 3' untranslated region (UTR) of DROSHA is predicted to abolish the binding site of hsa-mir-1298 [PMC4229095]. Hsa-mir-1298 has been associated with improved survival in patients, along with hsa-miR-122 and hsa-miR-200 [PMC10093233]. LncRNA-RP11-583F2.2 has been identified as a competing endogenous RNA (ceRNA) targeting hsa-mir-1298 through the lncRBA database [PMC7324892]. Bioinformatics analysis has identified hsa-mir-1298 and lncRNA-RP11-583F2.2 as promising non-coding RNAs relevant to hepatocellular carcinoma (HCC) based on microarray studies and clinical validation in HCC patients versus controls [PMC7324892]. Pathway enrichment analysis has revealed that hsa-mir-1298 is associated with target genes related to carcinogenesis, exosome secretion, apoptosis, and cell adhesion through the Diana database [PMC7324892]. Hsa-circ_0078383 is targeted by multiple miRNAs including hsa-mir-1298 [PMC8483823]. In a study focusing on neural cell-type-specific response, hsa-mir-1298 was found to be significantly up-regulated in Hypr-infected neurons but down-regulated in Hypr-infected astrocytes [PMC9167876]. Among the predicted mRNA targets of hsa-mir-1298, RSAD2 and CMPK2 were identified as the most important, as they have been documented to interfere with flavivirus infection [PMC9167876].

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAUUCGGCUGUCCAGAUGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus bta-miR-1298
  2. Canis lupus familiaris (dog) Cfa-Mir-1298_5p (mature (guide))
  3. Cervus elaphus (red deer) Cel-miR-1298
  4. Equus caballus eca-miR-1298
  5. Macaca mulatta mml-miR-1298-5p
  6. Mus musculus (house mouse) mmu-miR-1298-5p
  7. Oryctolagus cuniculus ocu-miR-1298-5p
  8. Pan troglodytes ptr-miR-1298
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-1298
  10. Rattus norvegicus (Norway rat) rno-miR-1298
Publications