v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila mojavensis Dmo-Mir-14_3p (mature (guide)) URS00003DE3EC_7230

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Drosophila mojavensis. Annotated by 1 database (MirGeneDB). Found in the Drosophila mojavensis reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UCAGUCUUUUUCUCUCUCCUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Acyrthosiphon pisum (pea aphid) api-miR-14
    2. Aedes aegypti aae-miR-14
    3. Bactrocera dorsalis (oriental fruit fly) bdo-miR-14
    4. Blattella germanica Bge-Mir-14_3p (mature (guide))
    5. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-14
    6. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-14
    7. Culex quinquefasciatus (southern house mosquito) cqu-miR-14
    8. Dinoponera quadriceps dqu-miR-14-3p
    9. Drosophila ananassae Dan-Mir-14_3p (mature (guide))
    10. Drosophila melanogaster dme-miR-14-3p
    11. Drosophila simulans Dsi-Mir-14_3p (mature (guide))
    12. Drosophila yakuba Dya-Mir-14_3p (mature (guide))
    13. Heliconius melpomene hme-miR-14
    14. Manduca sexta (tobacco hornworm) mse-miR-14
    15. Polistes canadensis pca-miR-14-3p
    16. Spodoptera frugiperda sfr-miR-14-3p
    17. Tribolium castaneum (red flour beetle) tca-miR-14-3p
    18. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3348533