Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-331 URS00003DDE27_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-331: Seventeen DE mature miRNAs, including cfa-mir-331, were validated by qRT-PCR in the study [PMC5844969]. The down-regulation of cfa-mir-331 at 36 dpi may promote the host TH1 immune response in T. canis infection by affecting the expression of sema7a [PMC9773451]. Sema7a was predicted to be a potential target gene of cfa-mir-331 [PMC9773451]. The study also found that cfa-mir-331 and novel_129 were significantly down-regulated at 36 dpi [PMC9773451]. At this time point, 27 differentially expressed miRNAs, including cfa-mir-331 and novel_129, were predicted to regulate 1,167 potential target genes [PMC9773451]. cfa-mir-331, along with cfa-miR-193b and novel_328, is associated with the host immune response [PMC9773451]. At 96 hpi, the upregulation of cfa-mir-331 is positively correlated with the host inflammatory response and may enhance it by targeting sema7a and tnfrsf1a, which are negatively associated with inflammation [PMC9558963].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCCUGGGCCUAUCCUAGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Artibeus jamaicensis aja-miR-331
  2. Bos taurus bta-miR-331-3p
  3. Cavia porcellus cpo-miR-331-3p
  4. Cervus elaphus (red deer) cel-miR-331
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-331-3p
  6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-331_3p (mature (guide))
  7. Equus caballus eca-miR-331
  8. Homo sapiens (human) hsa-miR-331-3p
  9. Macaca mulatta mml-miR-331-3p
  10. Mus musculus (house mouse) mmu-miR-331-3p
  11. Oryctolagus cuniculus ocu-miR-331-3p
  12. Pan troglodytes ptr-miR-331
  13. Pteropus alecto pal-miR-331-3p
  14. Rattus norvegicus (Norway rat) rno-miR-331-3p
  15. Sus scrofa ssc-miR-331-3p
Publications