Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) Dan-Mir-92-o15_3p (mature (guide)) URS00003DCEB7_9361

  • 22 nucleotides
  • 1 database (MirGeneDB)
  • Found in 18 other species
  • miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUUGCACUAGUCCCGGCCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bactrocera dorsalis (oriental fruit fly) bdo-miR-92b
  2. Cochliomyia hominivorax mature cho-miR-92b
  3. Cochliomyia macellaria mature cma-miR-92b
  4. Drosophila ananassae dan-miR-92b
  5. Drosophila erecta der-miR-92b
  6. Drosophila grimshawi dgr-miR-92b
  7. Drosophila melanogaster (fruit fly) dme-miR-92b-3p
  8. Drosophila mojavensis dmo-miR-92b
  9. Drosophila persimilis dpe-miR-92b
  10. Drosophila pseudoobscura dps-miR-92b
  11. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294402_df_nrg
  12. Drosophila sechellia dse-miR-92b
  13. Drosophila simulans dsi-miR-92b
  14. Drosophila virilis dvi-miR-92b-3p
  15. Drosophila willistoni dwi-miR-92b
  16. Drosophila yakuba dya-miR-92b
  17. Eisenia fetida Efe-Mir-92-o40_3p (mature (guide))
  18. Eurosta solidaginis (goldenrod gall fly) miR-92b