Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila willistoni dwi-miR-92b URS00003DCEB7_7260

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Drosophila willistoni. Annotated by 2 databases (Ensembl Metazoa, miRBase). Described in 1 paper. Drosophila willistoni dwi-miR-92b sequence is a product of FBtr0297863_df_nrg gene. Found in the Drosophila willistoni reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAUUGCACUAGUCCCGGCCUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 17 other species

    1. Bactrocera dorsalis (oriental fruit fly) bdo-miR-92b
    2. Cochliomyia hominivorax mature cho-miR-92b
    3. Cochliomyia macellaria mature cma-miR-92b
    4. Dasypus novemcinctus Dan-Mir-92-o15_3p (mature (guide))
    5. Drosophila ananassae dan-miR-92b
    6. Drosophila erecta der-miR-92b
    7. Drosophila grimshawi dgr-miR-92b
    8. Drosophila melanogaster (fruit fly) dme-miR-92b-3p
    9. Drosophila mojavensis dmo-miR-92b
    10. Drosophila persimilis dpe-miR-92b
    11. Drosophila pseudoobscura dps-miR-92b
    12. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294402_df_nrg
    13. Drosophila sechellia dse-miR-92b
    14. Drosophila simulans dsi-miR-92b
    15. Drosophila virilis dvi-miR-92b-3p
    16. Drosophila yakuba dya-miR-92b
    17. Eisenia fetida Efe-Mir-92-o39_3p (mature (guide))
    18. Eurosta solidaginis (goldenrod gall fly) miR-92b