Nomascus leucogenys (Northern white-cheeked gibbon) nle-let-7g (ENSNLEG00000024192.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (Northern white-cheeked gibbon) nle-let-7g (ENSNLEG00000024192.2) URS00003DBD40_61853

84 nucleotides
1 database (Ensembl)
Found in 19 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

Aotus nancymaae miRNA (ENSANAG00000012150.1)
Carlito syrichta miRNA (ENSTSYG00000022108.2)
Cebus imitator microRNA let-7g (ENSCCAG00000016804.1)
Cercocebus atys miRNA (ENSCATG00000019717.1)
Colobus angolensis palliatus miRNA (ENSCANG00000004103.1)
Gorilla gorilla gorilla microRNA let-7g (ENSGGOG00000034381.2)
Homo sapiens let-7g stem-loop (hsa-let-7g)
Macaca mulatta let-7g stem-loop (mml-let-7g)
Macaca nemestrina miRNA (ENSMNEG00000024599.1)
Mandrillus leucophaeus miRNA (ENSMLEG00000009527.1)
Pan paniscus (bonobo) ppa-let-7g (ENSPPAG00000014875.1)
Panthera pardus (leopard) microRNA let-7g (ENSPPRG00000013514.1)
Panthera tigris altaica (Tiger) microRNA let-7g (ENSPTIG00000003470.1)
Pan troglodytes ptr-let-7g (ENSPTRG00000027678.2)
Pongo abelii (Sumatran orangutan) miRNA
Pongo pygmaeus let-7g stem-loop (ppy-let-7g)
Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000001954.1)
Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000020029.1)
Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000025542.1)

2D structure