v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000020029.1) secondary structure diagram

Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000020029.1) URS00003DBD40_61621

Automated summary: This pre miRNA sequence is 84 nucleotides long and is found in Rhinopithecus bieti. Annotated by 1 database (Ensembl). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (let-7, RF00027). Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000020029.1) sequence is a product of ENSRBIG00000020029.1 gene. Found in the Rhinopithecus bieti reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    AGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000012150.1)
    2. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000022108.2)
    3. Cercocebus atys miRNA (ENSCATG00000019717.1)
    4. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000004103.1)
    5. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA let-7g (ENSGGOG00000034381.2)
    6. Homo sapiens let-7g stem-loop (hsa-let-7g)
    7. Macaca fascicularis (Crab-eating macaque) miRNA
    8. Macaca mulatta let-7g stem-loop (mml-let-7g)
    9. Macaca nemestrina miRNA (ENSMNEG00000024599.1)
    10. Mandrillus leucophaeus miRNA (ENSMLEG00000009527.1)
    11. Nomascus leucogenys (Northern white-cheeked gibbon) nle-let-7g (ENSNLEG00000024192.2)
    12. Pan paniscus ppa-let-7g (ENSPPAG00000014875.1)
    13. Panthera pardus miRNA (ENSPPRG00000013514.1)
    14. Panthera tigris altaica miRNA MIRLET7G (ENSPTIG00000003470.1)
    15. Pan troglodytes (chimpanzee) ptr-let-7g (ENSPTRG00000027678.2)
    16. Papio anubis miRNA (ENSPANG00000004779.2)
    17. Pongo abelii miRNA
    18. Pongo pygmaeus let-7g stem-loop (ppy-let-7g)
    19. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000001954.1)
    20. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000025542.1)
     2D structure