Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-101b-5p URS00003D948A_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-101b: Mmu-mir-101b is a microRNA (miRNA) that is embedded in the intron of Rcl1 [PMC1449887]. The TransmiR database was used to predict potential transcription factors (TFs) of mmu-mir-101b, and 104 proteins were identified as potential TFs [PMC9903543]. To confirm that CEBPα is the TF of mmu-mir-101b, a 20,000-bp sequence in front of pre–miR-101b was input into the JASPAR database [PMC9903543]. The region that includes mmu-mir-101b may fold back upon the mRNA precursor, forming a stem loop to silence the Slc1a1 gene as a target [PMC1449887]. TargetScan analysis suggests that Slc1a1 is indeed a target of mmu-mir-101b [PMC1449887]. PCR primer sets for mmu-mir-101b were specific for mouse microRNAs [PMC5295159]. In a study, mmu-mir-101b was found to be downregulated [PMC9198802]. References: [PMC9903543] TransmiR v2.0 database. http://www.cuilab.cn/transmir [Additional file 1: Fig] PMC9903543 [http://jaspar.genereg.net/] PMC9903543 [PMC1449887] http://genes.mit.edu/targetscan [http://genes.mit.edu/targetscan] PMC1449887 [http://genes.mit.edu/targetscan] PMC5295159 [PMC9198802]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGUUAUCAUGGUACCGAUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Cavia porcellus (domestic guinea pig) cpo-miR-101-2-5p
  2. Dasypus novemcinctus dno-miR-101-2-5p
  3. Macaca mulatta mml-miR-101-2-5p
  4. Monodelphis domestica mdo-miR-101-2-5p
  5. Oryctolagus cuniculus (rabbit) ocu-miR-101-2-5p
Publications