Automated summary: This pre miRNA sequence is 100 nucleotides long and is found in Drosophila melanogaster. Annotated by 5 databases (Rfam, ENA, RefSeq, miRBase, FlyBase). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-274, RF00822). Drosophila melanogaster (fruit fly) microRNA dme-mir-274 precursor sequence is a product of mir-274 precursor, mir-274, dme-mir-274 precursor, mir-274 precursor RNA, 274 precursor RNA, 274 precursor RN, mir-274 precurso, FBgn0262437 genes. Found in the fruit fly reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UCCUGUGUUGCAGUUUCGUUUUGUGACCGACACUAACGGGUAAUUGUUUGGCCGCCAGGAUUACUCGUUUUUGCGAUCACAAAUUAUGAAAUUGCAGCAA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.