Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays zma-miR399i-3p URS00003CFBD5_4577

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Zea mays. Annotated by 3 databases (RefSeq, miRBase, ENA). Zea mays zma-miR399i-3p sequence is a product of miR399i-3p, miR399e, MIR399e, miR399i, miR399j-3p, miR399, zma-miR399j, zma-miR399i, MIR399j, miR399j, miR399e-3p, zma-miR399i-3p, zma-miR399j-3p, MIR399i, zma-miR399e, zma-miR399e-3p genes. Found in the Zea mays reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGCCAAAGGAGAGUUGCCCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 21 other species

    1. Ananas comosus (pineapple) microRNA 399b
    2. Arabidopsis lyrata aly-miR399c-3p
    3. Arabidopsis thaliana ath-miR399b
    4. Asparagus officinalis (garden asparagus) aof-miR399a
    5. Citrus sinensis csi-miR399d-3p
    6. Corchorus olitorius aly-miR399a-
    7. Fragaria vesca subsp. vesca fve-miR399a
    8. Glycine max (soybean) gma-miR399a
    9. Helianthus annuus sRNA HannXRQ_Chr03g0085865
    10. Malus domestica mdm-miR399i
    11. Manihot esculenta (cassava) mes-miR399f
    12. Medicago truncatula mtr-miR399p
    13. Oryza sativa Japonica Group microRNA osa-miR399d
    14. Oryza sativa osa-miR399d
    15. Phaseolus vulgaris pvu-miR399a
    16. Picea abies pab-miR399d
    17. Ricinus communis rco-miR399a
    18. Sorghum bicolor sbi-miR399d
    19. Theobroma cacao tcc-miR399i
    20. Vigna unguiculata vun-miR399a
    21. Vitis vinifera (wine grape) vvi-miR399b
    Publications New