Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR399d URS00003CFBD5_39947

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Described in 1 paper. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR399d sequence is a product of miR399d, osa-miR399d, miR399 genes. Found in the japanese rice reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGCCAAAGGAGAGUUGCCCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Ananas comosus (pineapple) microRNA 399b
    2. Arabidopsis lyrata aly-miR399b-3p
    3. Arabidopsis thaliana (thale cress) ath-miR399c-3p
    4. Asparagus officinalis (garden asparagus) aof-miR399a
    5. Citrus sinensis csi-miR399d-3p
    6. Corchorus olitorius aly-miR399a-
    7. Fragaria vesca subsp. vesca fve-miR399a
    8. Glycine max gma-miR399b
    9. Helianthus annuus sRNA HannXRQ_Chr03g0085865
    10. Malus domestica (apple) mdm-miR399i
    11. Manihot esculenta (cassava) mes-miR399f
    12. Medicago truncatula (barrel medic) mtr-miR399p
    13. Oryza sativa (rice) osa-miR399d
    14. Phaseolus vulgaris pvu-miR399a
    15. Picea abies (Norway spruce) pab-miR399d
    16. Ricinus communis rco-miR399a
    17. Sorghum bicolor (sorghum) sbi-miR399d
    18. Theobroma cacao tcc-miR399i
    19. Vigna unguiculata vun-miR399a
    20. Vitis vinifera vvi-miR399c
    21. Zea mays zma-miR399e-3p