Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-320a URS00003CF1AD_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-320a: Bta-mir-320a is a microRNA that has been found to be highly abundant and differentially expressed in various studies involving cattle [PMC5341059] [PMC4517789] [PMC4990326]. It has been shown to exhibit a significantly differential expression pattern between different cattle breeds [PMC5341059]. Bta-mir-320a is one of the miRNAs that follow a pattern of variant expression, where there is no predominant isomiR [PMC4517789]. It has also been found to have different expression levels during different seasons [PMC4990326]. Bta-mir-320a, along with other miRNAs, has been identified as a regulator in glucose and lipid metabolism in cattle [PMC4090223]. It targets genes such as adenosine monophosphate-activated protein kinase alpha 1 (PRKAA1), peroxisome proliferator-activated receptor-gamma (PPARG), and peroxisome proliferator-activated receptor-alpha (PPARA) [PMC4090223]. Bta-mir-320a is located on bovine chromosomes 8 and 20, with two isoforms identified [PMC4090223]. It has also been found to be highly abundant in certain conditions such as subclinical mastitis and dairy cows' dry secretions [PMC10000098] [PMC9445238]. Overall, bta-mir-320a plays a significant role in various biological processes and may have potential implications for cattle breeding and health.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGCUGGGUUGAGAGGGCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Canis lupus familiaris (dog) cfa-miR-320
  2. Capra hircus chi-miR-320-3p
  3. Cavia porcellus Cpo-Mir-320_3p (mature (guide))
  4. Cricetulus griseus cgr-miR-320a
  5. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-320_3p (mature (guide))
  6. Echinops telfairi Ete-Mir-320_3p (mature (guide))
  7. Gorilla gorilla gorilla ggo-miR-320a (MIR320A)
  8. Gorilla gorilla (western gorilla) ggo-miR-320a
  9. Homo sapiens (human) hsa-miR-320a-3p
  10. Macaca mulatta (Rhesus monkey) mml-miR-320a
  11. Microcebus murinus (gray mouse lemur) mmr-miR-320a
  12. Mus musculus mmu-miR-320-3p
  13. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-320a
  14. Oryctolagus cuniculus (rabbit) Ocu-Mir-320_3p (mature (guide))
  15. Otolemur garnettii oga-miR-320a
  16. Pan paniscus ppa-miR-320a
  17. Pan troglodytes (chimpanzee) ptr-miR-320a
  18. Papio hamadryas (hamadryas baboon) pha-miR-320a
  19. Pongo pygmaeus (Bornean orangutan) ppy-miR-320a
  20. Pteropus alecto pal-miR-320-3p
  21. Rattus norvegicus rno-miR-320-3p
Publications