Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Otolemur garnettii (small-eared galago) oga-miR-320a URS00003CF1AD_30611

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGCUGGGUUGAGAGGGCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Bos taurus (cattle) bta-miR-320a
  2. Canis lupus familiaris (dog) cfa-miR-320
  3. Capra hircus chi-miR-320-3p
  4. Cavia porcellus Cpo-Mir-320_3p (mature (guide))
  5. Cricetulus griseus cgr-miR-320a
  6. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-320_3p (mature (guide))
  7. Echinops telfairi Ete-Mir-320_3p (mature (guide))
  8. Gorilla gorilla gorilla ggo-miR-320a (MIR320A)
  9. Gorilla gorilla (western gorilla) ggo-miR-320a
  10. Homo sapiens (human) hsa-miR-320a-3p
  11. Macaca mulatta (Rhesus monkey) mml-miR-320a
  12. Microcebus murinus (gray mouse lemur) mmr-miR-320a
  13. Mus musculus mmu-miR-320-3p
  14. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-320a
  15. Oryctolagus cuniculus (rabbit) Ocu-Mir-320_3p (mature (guide))
  16. Pan paniscus ppa-miR-320a
  17. Pan troglodytes (chimpanzee) ptr-miR-320a
  18. Papio hamadryas (hamadryas baboon) pha-miR-320a
  19. Pongo pygmaeus (Bornean orangutan) ppy-miR-320a
  20. Pteropus alecto pal-miR-320-3p
  21. Rattus norvegicus rno-miR-320-3p