Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-320-3p URS00003CF1AD_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-320: Mmu-mir-320 is a member of the murine stem-loop mir-320 family and is conserved to hsa-miR-320a-3p [PMC8479292]. Recent evidence suggests that certain miRNAs, including mmu-mir-320, can bypass Drosha processing and enter Dicer machinery directly [PMC5716067]. Mmu-mir-320 has been found to be regulated by the transcription factor Esrrb, along with other miRNAs such as mmu-mir-210, mmu-mir-99b, mmu-mir-499, mmu-mir-196b, mmu-mir-106b, and mmu-mir-32 [PMC9149258]. Additionally, knockout mice for mmu-mir-320 have shown a reduced proportion of oocytes that develop into two-cell and blastocyst stage embryos [PMC9778079]. Mmu-miR-320 has also been identified as a regulator for lung non-specific genes [PMC3866260]. These findings suggest that mmu-miR-320 plays a role in various biological processes and may have implications in diseases such as diabetes mellitus and coronary artery disease. Further research is needed to fully understand the functions and mechanisms of action of this miRNA.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGCUGGGUUGAGAGGGCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Bos taurus (cattle) bta-miR-320a
  2. Canis lupus familiaris (dog) cfa-miR-320
  3. Capra hircus chi-miR-320-3p
  4. Cavia porcellus Cpo-Mir-320_3p (mature (guide))
  5. Cricetulus griseus cgr-miR-320a
  6. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-320_3p (mature (guide))
  7. Echinops telfairi Ete-Mir-320_3p (mature (guide))
  8. Gorilla gorilla gorilla ggo-miR-320a (MIR320A)
  9. Gorilla gorilla (western gorilla) ggo-miR-320a
  10. Homo sapiens (human) hsa-miR-320a-3p
  11. Macaca mulatta (Rhesus monkey) mml-miR-320a
  12. Microcebus murinus (gray mouse lemur) mmr-miR-320a
  13. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-320a
  14. Oryctolagus cuniculus (rabbit) Ocu-Mir-320_3p (mature (guide))
  15. Otolemur garnettii oga-miR-320a
  16. Pan paniscus ppa-miR-320a
  17. Pan troglodytes (chimpanzee) ptr-miR-320a
  18. Papio hamadryas (hamadryas baboon) pha-miR-320a
  19. Pongo pygmaeus (Bornean orangutan) ppy-miR-320a
  20. Pteropus alecto pal-miR-320-3p
  21. Rattus norvegicus rno-miR-320-3p
Publications