Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-320a-3p URS00003CF1AD_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (MalaCards, LncBase, miRBase, TarBase, GeneCards, ENA, RefSeq). Described in 45 papers. Homo sapiens (human) hsa-miR-320a-3p sequence is a product of hsa-miR-320a, miR-320, MIR320A, miR-320a, hsa-miR-320a-3p, miR-320a-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 14-3-3, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 182-FIP, 2-COP, 209L8, 2700066J21Rik, 2C18.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAAAGCUGGGUUGAGAGGGCGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Bos taurus bta-miR-320a
    2. Canis lupus familiaris cfa-miR-320
    3. Capra hircus chi-miR-320-3p
    4. Cricetulus griseus cgr-miR-320a
    5. Gorilla gorilla ggo-miR-320a
    6. Macaca mulatta (Rhesus monkey) mml-miR-320a
    7. Microcebus murinus (gray mouse lemur) mmr-miR-320a
    8. Mus musculus (house mouse) mmu-miR-320-3p
    9. Nomascus leucogenys nle-miR-320a
    10. Otolemur garnettii (small-eared galago) oga-miR-320a
    11. Pan paniscus ppa-miR-320a
    12. Pan troglodytes (chimpanzee) ptr-miR-320a
    13. Papio hamadryas (hamadryas baboon) pha-miR-320a
    14. Pongo pygmaeus (Bornean orangutan) ppy-miR-320a
    15. Pteropus alecto (black flying fox) pal-miR-320-3p
    16. Rattus norvegicus rno-miR-320-3p