Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-323 URS00003CCAB4_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACAUUACACGGUCGACCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus (cattle) Bta-Mir-154-P3a-v1_3p (mature (guide))
  2. Capra hircus chi-miR-323a-3p
  3. Cavia porcellus cpo-miR-323a-3p
  4. Cervus elaphus cel-miR-323
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-323a-3p
  6. Equus caballus (horse) eca-miR-323-3p
  7. Homo sapiens (human) hsa-miR-323a-3p
  8. Macaca mulatta (Rhesus monkey) mml-miR-323a-3p
  9. Mus musculus mmu-miR-323-3p
  10. Oryctolagus cuniculus (rabbit) Ocu-Mir-154-P3a-v1_3p (mature (guide))
  11. Ovis aries oar-miR-323a-3p
  12. Pan paniscus ppa-miR-323
  13. Pan troglodytes (chimpanzee) ptr-miR-323
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-323-3p
  15. Pteropus alecto pal-miR-323-3p
  16. Rattus norvegicus rno-miR-323-3p
Publications