Pteropus alecto (black flying fox) pal-miR-323-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pteropus alecto (black flying fox) pal-miR-323-3p URS00003CCAB4_9402

21 nucleotides
1 database (miRBase)
Found in 16 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CACAUUACACGGUCGACCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

Bos taurus (cattle) Bta-Mir-154-P3a-v1_3p (mature (guide))
Canis lupus familiaris (dog) cfa-miR-323
Capra hircus chi-miR-323a-3p
Cavia porcellus cpo-miR-323a-3p
Cervus elaphus cel-miR-323
Dasypus novemcinctus (nine-banded armadillo) dno-miR-323a-3p
Equus caballus (horse) eca-miR-323-3p
Homo sapiens (human) hsa-miR-323a-3p
Macaca mulatta (Rhesus monkey) mml-miR-323a-3p
Mus musculus mmu-miR-323-3p
Oryctolagus cuniculus (rabbit) Ocu-Mir-154-P3a-v1_3p (mature (guide))
Ovis aries oar-miR-323a-3p
Pan paniscus ppa-miR-323
Pan troglodytes (chimpanzee) ptr-miR-323
Pongo pygmaeus (Bornean orangutan) ppy-miR-323-3p
Rattus norvegicus rno-miR-323-3p