Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) microRNA bta-mir-23a precursor secondary structure diagram

Bos taurus (cattle) microRNA bta-mir-23a precursor URS00003C8664_9913

Automated summary: This pre miRNA sequence is 73 nucleotides long and is found in Bos taurus. Annotated by 3 databases (RefSeq, miRBase, ENA). Described in 5 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-23, RF00642). Bos taurus (cattle) microRNA bta-mir-23a precursor sequence is a product of MIR23A, mir-23a precurso, bta-mir-23a precursor, 23a, 23, mir-23a, mir-23a precursor genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGCCGGCUGGGGUUCCUGGGGAUGGGAUUUGCUGCCUGUCACAAAUCACAUUGCCAGGGAUUUCCAACCGACC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 6 other species

    1. Ailuropoda melanoleuca (giant panda) mir-23
    2. Capra hircus (Goat) chi-mir-23a
    3. Carlito syrichta (Philippine tarsier) miRNA
    4. Ovis aries microRNA oar-mir-23a precursor
    5. Panthera pardus microRNA 23a
    6. Panthera tigris altaica (Tiger) microRNA 23a
    7. Pteropus vampyrus microRNA 23a
    2D structure New