Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-27a URS00003B95DA_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-mir-27a: Oar-mir-27a is a sheep miRNA that is immune-related and accounts for about 98% of the top 20 sheep miRNAs [PMC7070426]. It has been found to have a targeting relationship with circLTBP1 in follicular and luteal phase ovarian tissues from monotocous and polytocous sheep [PMC8532869]. Oar-mir-27a, along with other miRNAs such as oar-miR-181a, oar-miR-136/oar-miR-127, and oar-miR-22-3p, has been found to be correlated with novel_circ_0017815 (RBPMS), novel_circ_0000417 (LOC106990833), novel_circ_0004065 (PAWR), and novel_circ_0016586 (INPP5F) in relation to sheep reproduction [PMC8532869]. Oar-mir-27a has also been identified as a target miRNA site in circRNAs through competitive endogenous RNA network analysis, along with other miRNAs such as oar-miR-16b, oar-miR-200a/b/c, oar-miR-181a, oar-miR-10a/b, and oar-miR432 [PMC8300399]. Furthermore, it has been found that these miRNAs, including oar-mir-27a, are correlated with novel_circ_0005497 (LTBP1), novel_circ_0006554 (INSR), novel_circ_0016082 (GREB1L), novel_circ_0005617 (IL1RL1), novel_circ_0005884 (SNX13), novel_circ_0014289 (CYP11A1), novel_circ_0008937 (COL12A1), novel_circ_0005617 (IL1RL1), novel_circ_0002309 (ITGAV), and novel_circ_0010140 (COL14A1) in relation to sheep fecundity [PMC8300399]. Based on miRNA target site prediction analysis, oar-mir-27a has been identified as a potential target of novel_circ_0005497 [PMC8300399].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCACAGUGGCUAAGUUCCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 44 other species

  1. Alligator mississippiensis ami-miR-27a-3p
  2. Anolis carolinensis aca-miR-27a-3p
  3. Bos taurus (cattle) Bta-Mir-27-P3_3p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-27a
  5. Callorhinchus milii Cmi-Mir-27-P3_3p (mature (guide))
  6. Canis lupus familiaris Cfa-Mir-27-P3_3p (mature (guide))
  7. Capra hircus (goat) miR-27a
  8. Cervus elaphus cel-miR-27a-3p
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-27-P3_3p (mature (guide))
  10. Chrysemys picta cpi-miR-27a-3p
  11. Cricetulus griseus (Chinese hamster) cgr-miR-27a-3p
  12. Cyprinus carpio ccr-miR-27a
  13. Danio rerio Dre-Mir-27-P1_3p (mature (guide))
  14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-27a-3p
  15. Echinops telfairi Ete-Mir-27-P3_3p (mature (guide))
  16. Equus caballus eca-miR-27a
  17. Gadus morhua Gmo-Mir-27-P1_3p (mature (guide))
  18. Gallus gallus (chicken) Gga-Mir-27-P3_3p (mature (guide))
  19. Gekko japonicus Gja-Mir-27-P3_3p (mature (guide))
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-27a
  21. Homo sapiens hsa-miR-27a-3p
  22. Latimeria chalumnae Lch-Mir-27-P3_3p (mature (guide))
  23. Lepisosteus oculatus (spotted gar) Loc-Mir-27-P1_3p (mature (guide))
  24. Macaca mulatta Mml-Mir-27-P3_3p (mature (guide))
  25. Maylandia zebra (zebra mbuna) mze-miR-27a
  26. Monodelphis domestica mdo-miR-27a-3p
  27. Monopterus albus Mal-Mir-27-P1_3p (mature (guide))
  28. Mus musculus (house mouse) mmu-miR-27a-3p
  29. Neolamprologus brichardi (lyretail cichlid) nbr-miR-27a
  30. Oreochromis niloticus oni-miR-27a
  31. Ornithorhynchus anatinus oan-miR-27a-3p
  32. Oryctolagus cuniculus Ocu-Mir-27-P3_3p (mature (guide))
  33. Pundamilia nyererei pny-miR-27a
  34. Python bivittatus pbv-miR-27a-3p
  35. Rattus norvegicus rno-miR-27a-3p
  36. Saimiri boliviensis boliviensis sbo-miR-27a
  37. Sarcophilus harrisii Sha-Mir-27-P3_3p (mature (guide))
  38. Scyliorhinus torazame (cloudy catshark) Sto-Mir-27-P3b_3p (mature (guide))
  39. Sus scrofa (pig) ssc-miR-27a
  40. Taeniopygia guttata (zebra finch) Tgu-Mir-27-P3_3p (mature (guide))
  41. Tetraodon nigroviridis Tni-Mir-27-P1_3p (mature (guide))
  42. Tursiops truncatus miR-27a
  43. Xenopus laevis (African clawed frog) Xla-Mir-27-P3c_3p (mature (guide))
  44. Xenopus tropicalis xtr-miR-27a
Publications