Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-let-7f-5p URS00003B7674_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-let-7f: Ssc-let-7f is a member of the let-7 family of microRNAs (miRNAs) that was found to be highly expressed throughout prenatal and postnatal development [PMC4423774]. In a study, the top 10 miRNAs expressed were ssc-miR-193a-3p, ssc-miR-423-5p, ssc-miR-320, ssc-miR-181a, ssc-miR-30a-3p, ssc-miR-378, ssc-miR-191, ssc-let7a, ssclet7f and ssclet7c [PMC4008308]. The let family of miRNAs (including ssclet7f) was found to be significantly differentially expressed between PRRSV-infected and mock-infected PAMs [PMC9550049]. In another study on E. coli F18-sensitive pigs, 11 miRNAs were identified with increased expression including sscmiR143, sscl et7f and others [PMC3427155]. In LPS-treated and control samples in a different study on PBMCs, bta-miR103,bta-mir19b,bta mir191,bta mir29b,bta mir15a,bta mir19a,bta mir30d,btamir30b5p,and members of the let family (including let 7f) were abundantly expressed [PMC7903524]. Overall these studies highlight the expression patterns of miRNAs including the highly expressed SSclet7f in various developmental stages and in response to different infections.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGAUUGUAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 60 other species

  1. Alligator mississippiensis (American alligator) Ami-Let-7-P2b1_5p (mature (guide))
  2. Anolis carolinensis aca-let-7f-5p
  3. Ateles geoffroyi (black-handed spider monkey) microRNA let-7f-1
  4. Bos taurus (cattle) bta-let-7f
  5. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7f
  6. Callorhinchus milii Cmi-Let-7-P2a4_5p (mature (guide))
  7. Canis lupus familiaris (dog) cfa-let-7f
  8. Capra hircus (goat) chi-let-7f-5p
  9. Cavia porcellus cpo-let-7f-5p
  10. Chiloscyllium plagiosum microRNA cpl-let-7f
  11. Chrysemys picta bellii Cpi-Let-7-P2b1_5p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-let-7f-5p
  13. Columba livia (rock pigeon) cli-let-7f-5p
  14. Cricetulus griseus cgr-let-7f
  15. Danio rerio (zebrafish) dre-let-7f
  16. Dasypus novemcinctus (nine-banded armadillo) dno-let-7f-5p
  17. Daubentonia madagascariensis (aye-aye) dma-let-7f
  18. Echinops telfairi Ete-Let-7-P2b1_5p (mature (guide))
  19. Eptatretus burgeri Ebu-Let-7-P2o11_5p (mature (guide))
  20. Equus caballus (horse) eca-let-7f
  21. Gadus morhua (Atlantic cod) gmo-let-7f-5p
  22. Gallus gallus (chicken) gga-let-7f-5p
  23. Gekko japonicus Gja-Let-7-P2b1_5p (mature (guide))
  24. Gorilla gorilla (western gorilla) microRNA let-7f-1
  25. Homo sapiens (human) hsa-let-7f-5p
  26. Ictalurus punctatus ipu-let-7f
  27. Lagothrix lagotricha microRNA let-7f-1
  28. Latimeria chalumnae Lch-Let-7-P2b1_5p (mature (guide))
  29. Lemur catta microRNA let-7f-1
  30. Lepisosteus oculatus (spotted gar) Loc-Let-7-P2b1_5p (mature (guide))
  31. Macaca mulatta mml-let-7f-5p
  32. Macaca nemestrina (pig-tailed macaque) microRNA let-7f-1
  33. Microcebus murinus mmr-let-7f
  34. Monodelphis domestica (gray short-tailed opossum) mdo-let-7f-5p
  35. Monopterus albus (swamp eel) Mal-Let-7-P2b1a_5p (mature (guide))
  36. Mus musculus mmu-let-7f-5p
  37. Nomascus leucogenys nle-let-7f
  38. Ophiophagus hannah (king cobra) oha-let-7f-5p
  39. Oreochromis niloticus oni-let-7f
  40. Ornithorhynchus anatinus (platypus) oan-let-7f-5p
  41. Oryctolagus cuniculus (rabbit) ocu-let-7f-5p
  42. Otolemur garnettii oga-let-7f
  43. Ovis aries miscellaneous RNA
  44. Pan paniscus ppa-let-7f
  45. Pan troglodytes ptr-let-7f
  46. Papio hamadryas (hamadryas baboon) pha-let-7f
  47. Pongo pygmaeus ppy-let-7f
  48. Pteropus alecto (black flying fox) pal-let-7f-5p
  49. Python bivittatus pbv-let-7f-5p
  50. Rattus norvegicus (Norway rat) rno-let-7f-5p
  51. Saguinus labiatus (red-chested mustached tamarin) microRNA let-7f-1
  52. Saimiri boliviensis boliviensis sbo-let-7f
  53. Sarcophilus harrisii Sha-Let-7-P2b1_5p (mature (guide))
  54. Sphenodon punctatus Spt-Let-7-P2b1_5p (mature (guide))
  55. Taeniopygia guttata tgu-let-7f-5p
  56. Tor tambroides (Thai mahseer) let-7f
  57. Tupaia chinensis tch-let-7f-5p
  58. Tursiops truncatus let-7f
  59. Xenopus laevis xla-let-7f-5p
  60. Xenopus tropicalis xtr-let-7f
Publications