v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-let-7f URS00003B7674_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-let-7f: Cfa-let-7f is an ecmiRNA that was highly expressed in all experimental groups, along with cfa-miR-451, cfa-let-7g, cfa-miR-486, and cfa-miR-486-3p [PMC9617701]. The expression levels of these miRNAs were the highest in each of the four groups [PMC9617701]. After SAR-related stress, NGS revealed that cfa-let-7f was significantly upregulated compared to the expression levels during rest time [PMC8881509]. This upregulation was validated by qPCR in a sample size of 22 [PMC8881509]. Differential expression analysis showed that only cfa-let-7f and cfa-let 7a were significantly upregulated at T1 compared to T0 [PMC8881509]. Additionally, miRNA families such as miR200, Mirlet 7, miR125, miR146, miR34, miR23, cfa-miR184, cfa-miR214 and cfa-miR141 were significantly upregulated with testicular RA intervention via administration of a CYP26B1 inhibitor and all-trans RA [PMC4049822].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGGUAGUAGAUUGUAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 60 other species

  1. Alligator mississippiensis (American alligator) Ami-Let-7-P2b1_5p (mature (guide))
  2. Anolis carolinensis aca-let-7f-5p
  3. Ateles geoffroyi (black-handed spider monkey) microRNA let-7f-1
  4. Bos taurus (cattle) bta-let-7f
  5. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7f
  6. Callorhinchus milii Cmi-Let-7-P2a4_5p (mature (guide))
  7. Capra hircus (goat) chi-let-7f-5p
  8. Cavia porcellus cpo-let-7f-5p
  9. Chiloscyllium plagiosum microRNA cpl-let-7f
  10. Chrysemys picta bellii Cpi-Let-7-P2b1_5p (mature (guide))
  11. Chrysemys picta (Painted turtle) cpi-let-7f-5p
  12. Columba livia (rock pigeon) cli-let-7f-5p
  13. Cricetulus griseus cgr-let-7f
  14. Danio rerio (zebrafish) dre-let-7f
  15. Dasypus novemcinctus (nine-banded armadillo) dno-let-7f-5p
  16. Daubentonia madagascariensis (aye-aye) dma-let-7f
  17. Echinops telfairi Ete-Let-7-P2b1_5p (mature (guide))
  18. Eptatretus burgeri Ebu-Let-7-P2o11_5p (mature (guide))
  19. Equus caballus (horse) eca-let-7f
  20. Gadus morhua (Atlantic cod) gmo-let-7f-5p
  21. Gallus gallus (chicken) gga-let-7f-5p
  22. Gekko japonicus Gja-Let-7-P2b1_5p (mature (guide))
  23. Gorilla gorilla (western gorilla) microRNA let-7f-1
  24. Homo sapiens (human) hsa-let-7f-5p
  25. Ictalurus punctatus ipu-let-7f
  26. Lagothrix lagotricha microRNA let-7f-1
  27. Latimeria chalumnae Lch-Let-7-P2b1_5p (mature (guide))
  28. Lemur catta microRNA let-7f-1
  29. Lepisosteus oculatus (spotted gar) Loc-Let-7-P2b1_5p (mature (guide))
  30. Macaca mulatta mml-let-7f-5p
  31. Macaca nemestrina (pig-tailed macaque) microRNA let-7f-1
  32. Microcebus murinus mmr-let-7f
  33. Monodelphis domestica (gray short-tailed opossum) mdo-let-7f-5p
  34. Monopterus albus (swamp eel) Mal-Let-7-P2b1a_5p (mature (guide))
  35. Mus musculus mmu-let-7f-5p
  36. Nomascus leucogenys nle-let-7f
  37. Ophiophagus hannah (king cobra) oha-let-7f-5p
  38. Oreochromis niloticus oni-let-7f
  39. Ornithorhynchus anatinus (platypus) oan-let-7f-5p
  40. Oryctolagus cuniculus (rabbit) ocu-let-7f-5p
  41. Otolemur garnettii oga-let-7f
  42. Ovis aries miscellaneous RNA
  43. Pan paniscus ppa-let-7f
  44. Pan troglodytes ptr-let-7f
  45. Papio hamadryas (hamadryas baboon) pha-let-7f
  46. Pongo pygmaeus ppy-let-7f
  47. Pteropus alecto (black flying fox) pal-let-7f-5p
  48. Python bivittatus pbv-let-7f-5p
  49. Rattus norvegicus (Norway rat) rno-let-7f-5p
  50. Saguinus labiatus (red-chested mustached tamarin) microRNA let-7f-1
  51. Saimiri boliviensis boliviensis sbo-let-7f
  52. Sarcophilus harrisii Sha-Let-7-P2b1_5p (mature (guide))
  53. Sphenodon punctatus Spt-Let-7-P2b1_5p (mature (guide))
  54. Sus scrofa ssc-let-7f-5p
  55. Taeniopygia guttata tgu-let-7f-5p
  56. Tor tambroides (Thai mahseer) let-7f
  57. Tupaia chinensis tch-let-7f-5p
  58. Tursiops truncatus let-7f
  59. Xenopus laevis xla-let-7f-5p
  60. Xenopus tropicalis xtr-let-7f
 Publications