Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7f-5p URS00003B7674_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (PSICQUIC, MalaCards, miRBase, MirGeneDB, LncBase, RefSeq, ENA, TarBase, GeneCards). Homo sapiens (human) hsa-let-7f-5p sequence is a product of let-7f-5p, hsa-let-7f-5p, let-7f, let-7, hsa-let-7f, MIRLET7F1, MIRLET7F2 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-Cys, 12CC4, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 15.5K, 182-FIP, 2'-PDE, 2610509L04Rik, 2C4D.

Interactions 10

According to PSICQUIC, Homo sapiens (human) hsa-let-7f-5p interacts with:

Interaction id Participant Synonyms
URS00003B7674_9606-0 P05231 P05231
URS00003B7674_9606-5 P05231 P05231
URS00003B7674_9606-1 P06213 P06213
URS00003B7674_9606-6 P06213 P06213
URS00003B7674_9606-2 P08069 P08069
URS00003B7674_9606-7 P08069 P08069
URS00003B7674_9606-8 Q5VWK5 Q5VWK5
URS00003B7674_9606-3 Q5VWK5 Q5VWK5
URS00003B7674_9606-4 Q9Y4H2 Q9Y4H2
URS00003B7674_9606-9 Q9Y4H2 Q9Y4H2

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGGUAGUAGAUUGUAUAGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 426 other species

    1. Alligator mississippiensis (American alligator) Ami-Let-7-P2b1_5p (mature (guide))
    2. Anolis carolinensis aca-let-7f-5p
    3. Ateles geoffroyi (black-handed spider monkey) microRNA let-7f-1
    4. Bos taurus bta-let-7f
    5. Callithrix jacchus cja-let-7f
    6. Callorhinchus milii Cmi-Let-7-P2a4_5p (mature (guide))
    7. Canis lupus familiaris cfa-let-7f
    8. Capra hircus (goat) chi-let-7f-5p
    9. Cavia porcellus cpo-let-7f-5p
    10. Chiloscyllium plagiosum microRNA cpl-let-7f
    11. Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P2b1_5p (mature (guide))
    12. Chrysemys picta (Painted turtle) cpi-let-7f-5p
    13. Columba livia (rock pigeon) cli-let-7f-5p
    14. Cricetulus griseus (Chinese hamster) cgr-let-7f
    15. Danio rerio (zebrafish) dre-let-7f
    16. Dasypus novemcinctus dno-let-7f-5p
    17. Daubentonia madagascariensis dma-let-7f
    18. Echinops telfairi Ete-Let-7-P2b1_5p (mature (guide))
    19. Eptatretus burgeri Ebu-Let-7-P2o11_5p (mature (guide))
    20. Equus caballus eca-let-7f
    21. Gadus morhua gmo-let-7f-5p
    22. Gallus gallus (chicken) gga-let-7f-5p
    23. Gekko japonicus Gja-Let-7-P2b1_5p (mature (guide))
    24. Gorilla gorilla (western gorilla) microRNA let-7f-1
    25. Ictalurus punctatus (channel catfish) ipu-let-7f
    26. Lagothrix lagotricha (brown woolly monkey) microRNA let-7f-1
    27. Latimeria chalumnae Lch-Let-7-P2b1_5p (mature (guide))
    28. Lemur catta microRNA let-7f-1
    29. Lepisosteus oculatus (spotted gar) Loc-Let-7-P2b1_5p (mature (guide))
    30. Macaca mulatta (Rhesus monkey) mml-let-7f-5p
    31. Macaca nemestrina microRNA let-7f-1
    32. Microcebus murinus mmr-let-7f
    33. Monodelphis domestica (gray short-tailed opossum) mdo-let-7f-5p
    34. Monopterus albus Mal-Let-7-P2b1a_5p (mature (guide))
    35. Mus musculus mmu-let-7f-5p
    36. Nomascus leucogenys nle-let-7f
    37. Ophiophagus hannah (king cobra) oha-let-7f-5p
    38. Oreochromis niloticus oni-let-7f
    39. Ornithorhynchus anatinus (platypus) oan-let-7f-5p
    40. Oryctolagus cuniculus ocu-let-7f-5p
    41. Otolemur garnettii oga-let-7f
    42. Ovis aries (sheep) miscellaneous RNA
    43. Pan paniscus (pygmy chimpanzee) ppa-let-7f
    44. Pan troglodytes ptr-let-7f
    45. Papio hamadryas (hamadryas baboon) pha-let-7f
    46. Pongo pygmaeus ppy-let-7f
    47. Pteropus alecto pal-let-7f-5p
    48. Python bivittatus (Burmese python) pbv-let-7f-5p
    49. Rattus norvegicus (Norway rat) rno-let-7f-5p
    50. Saguinus labiatus (red-chested mustached tamarin) microRNA let-7f-1
    51. Saimiri boliviensis boliviensis sbo-let-7f
    52. Sarcophilus harrisii Sha-Let-7-P2b1_5p (mature (guide))
    53. Sphenodon punctatus (tuatara) Spt-Let-7-P2b1_5p (mature (guide))
    54. Sus scrofa (pig) ssc-let-7f-5p
    55. Taeniopygia guttata (zebra finch) tgu-let-7f-5p
    56. Tor tambroides (Thai mahseer) let-7f
    57. Tupaia chinensis tch-let-7f-5p
    58. Tursiops truncatus (common bottlenose dolphin) let-7f
    59. Xenopus laevis xla-let-7f-5p
    60. Xenopus tropicalis xtr-let-7f
    Publications New