Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-let-7f-5p URS00003B7674_9031

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (ENA, RefSeq, miRBase, MirGeneDB). Gallus gallus (chicken) gga-let-7f-5p sequence is a product of let-7, let-7f, gga-let-7f-5p, MIRLET7F1, gga-let-7f, let-7f-5p genes. Found in the Gallus gallus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGGUAGUAGAUUGUAUAGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 60 other species

    1. Alligator mississippiensis (American alligator) Ami-Let-7-P2b1_5p (mature (guide))
    2. Anolis carolinensis aca-let-7f-5p
    3. Ateles geoffroyi microRNA let-7f-1
    4. Bos taurus (cattle) bta-let-7f
    5. Callithrix jacchus cja-let-7f
    6. Callorhinchus milii Cmi-Let-7-P2a4_5p (mature (guide))
    7. Canis lupus familiaris (dog) cfa-let-7f
    8. Capra hircus (goat) chi-let-7f-5p
    9. Cavia porcellus (domestic guinea pig) cpo-let-7f-5p
    10. Chiloscyllium plagiosum microRNA cpl-let-7f
    11. Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P2b1_5p (mature (guide))
    12. Chrysemys picta (Painted turtle) cpi-let-7f-5p
    13. Columba livia (rock pigeon) cli-let-7f-5p
    14. Cricetulus griseus (Chinese hamster) cgr-let-7f
    15. Danio rerio (zebrafish) dre-let-7f
    16. Dasypus novemcinctus (nine-banded armadillo) dno-let-7f-5p
    17. Daubentonia madagascariensis dma-let-7f
    18. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P2b1_5p (mature (guide))
    19. Eptatretus burgeri (inshore hagfish) Ebu-Let-7-P2o11_5p (mature (guide))
    20. Equus caballus eca-let-7f
    21. Gadus morhua (Atlantic cod) gmo-let-7f-5p
    22. Gekko japonicus Gja-Let-7-P2b1_5p (mature (guide))
    23. Gorilla gorilla (western gorilla) microRNA let-7f-1
    24. Homo sapiens (human) hsa-let-7f-5p
    25. Ictalurus punctatus ipu-let-7f
    26. Lagothrix lagotricha (brown woolly monkey) microRNA let-7f-1
    27. Latimeria chalumnae (coelacanth) Lch-Let-7-P2b1_5p (mature (guide))
    28. Lemur catta (Ring-tailed lemur) microRNA let-7f-1
    29. Lepisosteus oculatus Loc-Let-7-P2b1_5p (mature (guide))
    30. Macaca mulatta mml-let-7f-5p
    31. Macaca nemestrina (pig-tailed macaque) microRNA let-7f-1
    32. Microcebus murinus mmr-let-7f
    33. Monodelphis domestica mdo-let-7f-5p
    34. Monopterus albus Mal-Let-7-P2b1a_5p (mature (guide))
    35. Mus musculus mmu-let-7f-5p
    36. Nomascus leucogenys nle-let-7f
    37. Ophiophagus hannah (king cobra) oha-let-7f-5p
    38. Oreochromis niloticus oni-let-7f
    39. Ornithorhynchus anatinus (platypus) oan-let-7f-5p
    40. Oryctolagus cuniculus (rabbit) ocu-let-7f-5p
    41. Otolemur garnettii oga-let-7f
    42. Ovis aries (sheep) miscellaneous RNA
    43. Pan paniscus ppa-let-7f
    44. Pan troglodytes ptr-let-7f
    45. Papio hamadryas (hamadryas baboon) pha-let-7f
    46. Pongo pygmaeus (Bornean orangutan) ppy-let-7f
    47. Pteropus alecto pal-let-7f-5p
    48. Python bivittatus (Burmese python) pbv-let-7f-5p
    49. Rattus norvegicus rno-let-7f-5p
    50. Saguinus labiatus (red-chested mustached tamarin) microRNA let-7f-1
    51. Saimiri boliviensis boliviensis sbo-let-7f
    52. Sarcophilus harrisii Sha-Let-7-P2b1_5p (mature (guide))
    53. Sphenodon punctatus (tuatara) Spt-Let-7-P2b1_5p (mature (guide))
    54. Sus scrofa (pig) ssc-let-7f-5p
    55. Taeniopygia guttata tgu-let-7f-5p
    56. Tor tambroides let-7f
    57. Tupaia chinensis (Chinese tree shrew) tch-let-7f-5p
    58. Tursiops truncatus (common bottlenose dolphin) let-7f
    59. Xenopus laevis (African clawed frog) xla-let-7f-5p
    60. Xenopus tropicalis xtr-let-7f
    Publications