Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-207 URS00003B1C00_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-207: Mmu-mir-207 is a miRNA that has been studied in various contexts. In a study, it was found that mmu-mir-207 was one of the miRNAs that had potential binding sites for mmu_circRNA_018351, along with other miRNAs such as mmu-miR-877-3p, mmu-miR-1903, mmu-miR-667-5p, and mmu-miR-665-5p [PMC6089758]. Another study identified differentially expressed miRNAs and found that mmu-mir-207 was one of the upregulated miRNAs [PMC5819906]. Additionally, it was predicted that mmu-mir-207 was a downstream target of circRNA02370 [PMC9720296]. The fold changes of mmu-mir-207 obtained from microarray and qRT-PCR technology were comparable and showed the same trends [PMC3980334]. In another study, it was found that mmu-mir-207 had a fold change of 0.164 in forestomach tissue, indicating downregulation [PMC4209037]. Furthermore, in situ hybridization experiments using detection probes for mmu-mir-207 showed its presence in brain slices [PMC2777883]. Finally, another study identified changes in expression levels and found that mmu-mir 207 was downregulated [PMC9001960]. References: [PMC6089758] [PMC5819906] [PMC9720296] [PMC3980334] [PMC4209037] [PMC2777883] [PM9001960]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUUCUCCUGGCUCUCCUCCCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications