Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-18a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-18a precursor URS00003B0CDB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR18A: MIR18A is an oncogenic microRNA that is expressed in glioma cells. Its expression increases with both matrix stiffness and fibronectin concentration [PMC5876527]. Within the miR19-72 cluster, miR17, miR19a, and miR20a have higher levels of mature miRNA compared to MIR18A, miR19b, and miR92a [PMC9322280].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Aotus nancymaae microRNA 18a (ENSANAG00000006847.1)
  2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-18 precursor
  3. Bos taurus microRNA bta-mir-18a precursor
  4. Capra hircus (Goat) microRNA mir-18a (ENSCHIG00000001825.1)
  5. Carlito syrichta (Philippine tarsier) microRNA 18a (ENSTSYG00000028825.1)
  6. Cebus imitator microRNA 18a (ENSCCAG00000009401.1)
  7. Cercocebus atys (Sooty mangabey) microRNA 18a (ENSCATG00000022345.1)
  8. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000017374.1)
  9. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-18a (ENSGGOG00000030480.2)
  10. Gorilla gorilla microRNA ggo-mir-18a precursor
  11. Lagothrix lagotricha microRNA lla-mir-18 precursor
  12. Lemur catta microRNA lca-mir-18 precursor
  13. Macaca mulatta microRNA mml-mir-18a precursor
  14. Macaca nemestrina microRNA mne-mir-18 precursor
  15. Mandrillus leucophaeus microRNA 18a (ENSMLEG00000020493.1)
  16. Microcebus murinus mmr-mir-18 (ENSMICG00000018153.3)
  17. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 18a (ENSNLEG00000021479.2)
  18. Pan paniscus microRNA ppa-mir-18 precursor
  19. Panthera pardus (leopard) microRNA 18a (ENSPPRG00000013539.1)
  20. Panthera tigris altaica (Tiger) microRNA 18a (ENSPTIG00000003433.1)
  21. Pan troglodytes microRNA ptr-mir-18a precursor
  22. Pongo abelii miRNA
  23. Pongo pygmaeus microRNA ppy-mir-18a precursor
  24. Propithecus coquereli microRNA 18a (ENSPCOG00000010698.1)
  25. Rhinopithecus bieti microRNA 18a (ENSRBIG00000015235.1)
  26. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 18a (ENSRROG00000010065.1)
  27. Saguinus labiatus microRNA sla-mir-18 precursor
  28. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 18a (ENSSBOG00000001425.1)
2D structure Publications