Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-18a precursor URS00003B0CDB_9606

  • 71 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 50 species

Automated summary: This pre miRNA sequence is 71 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (Ensembl/GENCODE, GeneCards, MalaCards, RefSeq, HGNC, Ensembl, miRBase, ENA). Described in 55 papers. Matches 1 Rfam family (mir-17, RF00051). Homo sapiens (human) microRNA hsa-mir-18a precursor sequence is a product of mir-18a, mir-18a precurso, ENSG00000283815.1, MIR18A, hsa-mir-18a precursor, mir-18a precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 49 other species

    1. Aotus nancymaae miRNA (ENSANAG00000006847.1)
    2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-18 precursor
    3. Bos taurus (cattle) microRNA bta-mir-18a precursor
    4. Capra hircus (Goat) microRNA mir-18a (ENSCHIG00000001825.1)
    5. Carlito syrichta miRNA (ENSTSYG00000028825.1)
    6. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000022345.1)
    7. Colobus angolensis palliatus miRNA (ENSCANG00000017374.1)
    8. Gorilla gorilla gorilla ggo-mir-18a (ENSGGOG00000030480.2)
    9. Gorilla gorilla (western gorilla) microRNA ggo-mir-18a precursor
    10. Lagothrix lagotricha microRNA lla-mir-18 precursor
    11. Lemur catta microRNA lca-mir-18 precursor
    12. Macaca fascicularis (Crab-eating macaque) miRNA
    13. Macaca mulatta microRNA mml-mir-18a precursor
    14. Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-18 precursor
    15. Mandrillus leucophaeus miRNA (ENSMLEG00000020493.1)
    16. Microcebus murinus mmr-mir-18 (ENSMICG00000018153.3)
    17. Nomascus leucogenys miRNA (ENSNLEG00000021479.2)
    18. Pan paniscus microRNA ppa-mir-18 precursor
    19. Panthera pardus microRNA 18a (ENSPPRG00000013539.1)
    20. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000003433.1)
    21. Pan troglodytes (chimpanzee) microRNA ptr-mir-18a precursor
    22. Papio anubis (Olive baboon) miRNA (ENSPANG00000001454.2)
    23. Pongo abelii (Sumatran orangutan) miRNA
    24. Pongo pygmaeus microRNA ppy-mir-18a precursor
    25. Propithecus coquereli miRNA (ENSPCOG00000010698.1)
    26. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000015235.1)
    27. Rhinopithecus roxellana miRNA (ENSRROG00000010065.1)
    28. Saguinus labiatus microRNA sla-mir-18 precursor
    29. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000001425.1)