Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-152-3p URS00003AFD9B_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (LncBase, TarBase, MalaCards, ENA, IntAct, MirGeneDB, PSICQUIC, GeneCards, miRBase, RefSeq). Described in 68 papers. Homo sapiens (human) hsa-miR-152-3p sequence is a product of miR-152, hsa-miR-152-3p, hsa-miR-152, MIR152, miR-152-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 170A, 2310047H23Rik, 2PP2A, 30K, 39K2, 4833431A01Rik, 80K-L, AA, AADACL1, ABC1.

Interactions 11

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-152-3p interacts with:

Interaction id Participant Synonyms
EBI-26363573 intact:EBI-26353056 EBI-26353056 ENST00000402219 mrna_sos1
URS00003AFD9B_9606-0 P04156 P04156
URS00003AFD9B_9606-5 P04156 P04156
URS00003AFD9B_9606-6 P09038 P09038
URS00003AFD9B_9606-2 P09038 P09038
URS00003AFD9B_9606-7 P09038 P09038
URS00003AFD9B_9606-1 P09038 P09038
URS00003AFD9B_9606-3 P48509 P48509
URS00003AFD9B_9606-8 P48509 P48509
URS00003AFD9B_9606-9 P78536 P78536
URS00003AFD9B_9606-4 P78536 P78536

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCAGUGCAUGACAGAACUUGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 38 other species

    1. Alligator mississippiensis ami-miR-152-3p
    2. Bos taurus (cattle) Bta-Mir-148-P2_3p (mature (guide))
    3. Callithrix jacchus cja-miR-152
    4. Canis lupus familiaris cfa-miR-152
    5. Cavia porcellus (domestic guinea pig) cpo-miR-152-3p
    6. Cervus elaphus (red deer) cel-miR-152
    7. Chrysemys picta bellii Cpi-Mir-148-P2_3p (mature (guide))
    8. Chrysemys picta (Painted turtle) cpi-miR-152-3p
    9. Cricetulus griseus cgr-miR-152-3p
    10. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-148-P2_3p (mature (guide))
    11. Gorilla gorilla (western gorilla) ggo-miR-152
    12. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-152
    13. Macaca mulatta mml-miR-152-3p
    14. Monodelphis domestica Mdo-Mir-148-P2_3p (mature (guide))
    15. Mus musculus (house mouse) mmu-miR-152-3p
    16. Ornithorhynchus anatinus Oan-Mir-148-P2_3p (mature (guide))
    17. Oryctolagus cuniculus (rabbit) ocu-miR-152-3p
    18. Ovis aries oar-miR-152
    19. Pan troglodytes (chimpanzee) ptr-miR-152
    20. Pongo pygmaeus ppy-miR-152
    21. Pteropus alecto pal-miR-152-3p
    22. Rattus norvegicus rno-miR-152-3p
    23. Sarcophilus harrisii Sha-Mir-148-P2_3p (mature (guide))
    24. Sus scrofa ssc-miR-152
    25. Tupaia chinensis tch-miR-152