Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-939-3p URS00003AD2AA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-939: Hsa-mir-939 is a circulating miRNA that has been found to be capable of recognizing hepatocellular carcinoma (HCC) in cirrhotic patients [PMC6003936]. In a pan-cancer analysis, eight miRNA genes, including hsa-mir-939, were identified as candidate driver genes [PMC7648123]. Additionally, hsa-mir-939 was found to be significantly upregulated in one group compared to another [PMC8257506]. Circulating miRNAs have been studied for their potential as biomarkers for various diseases, including cancer. Hsa-mir-939 is one such circulating miRNA that has shown promise in recognizing HCC in cirrhotic patients [PMC6003936]. This suggests that hsa-mir-939 may have diagnostic potential for HCC. In a pan-cancer analysis, several miRNA genes were identified as candidate driver genes. Among them was hsa-mir-939 [PMC7648123]. This suggests that hsa-mir-939 may play a role in the development or progression of various types of cancer. Furthermore, hsa-mir-939 was found to be significantly upregulated between two groups. This indicates that the expression level of hsa-mir-939 may be associated with certain biological or clinical characteristics [PMC8257506]. Overall, the findings suggest that hsa-mir-939 may have diagnostic and prognostic potential in cancer. Further research is needed to fully understand the role and mechanisms of action of this circulating miRNA in cancer development and progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCUGGGCCUCUGCUCCCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications