Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-124-5p URS00003AA409_10090

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGUGUUCACAGCGGACCUUGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Alligator mississippiensis ami-miR-124-5p
  2. Cavia porcellus (domestic guinea pig) cpo-miR-124-5p
  3. Columba livia (rock pigeon) cli-miR-124-2-5p
  4. Danio rerio (zebrafish) dre-miR-124-5p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-124-5p
  6. Gadus morhua gmo-miR-124-5p
  7. Homo sapiens (human) hsa-miR-124-5p
  8. Ophiophagus hannah (king cobra) oha-miR-124-5p
  9. Ornithorhynchus anatinus oan-miR-124a-5p
  10. Oryctolagus cuniculus ocu-miR-124-5p
  11. Paralichthys olivaceus (Japanese flounder) pol-miR-124-5p
  12. Petromyzon marinus (sea lamprey) pma-miR-124-5p
  13. Python bivittatus pbv-miR-124b-5p
  14. Rattus norvegicus (Norway rat) rno-miR-124-5p
  15. Xenopus laevis xla-miR-124-5p
  16. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-4530693
Publications