Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis lyrata aly-miR396a-5p URS000039FDDC_59689

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Arabidopsis lyrata. Annotated by 2 databases (miRBase, ENA). Described in 1 paper. Arabidopsis lyrata aly-miR396a-5p sequence is a product of miR396a-5p, aly-miR396a-5p, miR396, aly-miR396a, miR396a genes. Found in the Arabidopsis lyrata reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUCCACAGCUUUCUUGAACUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 55 other species

    1. Acacia auriculiformis aau-miR396
    2. Acacia mangium amg-miR396
    3. Aegilops tauschii ata-miR396e-5p
    4. Ananas comosus (pineapple) vvi-miR396d
    5. Aquilegia coerulea aqc-miR396a
    6. Arabidopsis thaliana (thale cress) ath-miR396a-5p
    7. Asparagus officinalis aof-miR396b
    8. Brachypodium distachyon (stiff brome) bdi-miR396c-5p
    9. Bruguiera cylindrica bcy-miR396a
    10. Bruguiera gymnorhiza bgy-miR396a
    11. Camelina sativa (false flax) cas-miR396a
    12. Carica papaya (papaya) cpa-miR396
    13. Citrus sinensis csi-miR396b-5p
    14. Cucumis melo (muskmelon) cme-miR396b
    15. Digitalis purpurea dpr-miR396
    16. Eugenia uniflora eun-miR396b-5p
    17. Fragaria vesca subsp. vesca fve-miR396d
    18. Glycine max gma-miR396i-5p
    19. Gossypium hirsutum (cotton) ghr-miR396b
    20. Helianthus annuus (common sunflower) sRNA HannXRQ_Chr06g0181735
    21. Hevea brasiliensis hbr-miR396b
    22. Linum usitatissimum lus-miR396c
    23. Lotus japonicus lja-miR396
    24. Malus domestica mdm-miR396b
    25. Manihot esculenta (cassava) mes-miR396a
    26. Medicago truncatula mtr-miR396b-5p
    27. Nicotiana attenuata microRNA mir-396-like
    28. Nicotiana tabacum (common tobacco) nta-miR396a
    29. Oryza sativa Japonica Group microRNA osa-miR396b-5p
    30. Oryza sativa osa-miR396b-5p
    31. Populus tomentosa Pto-miR396b
    32. Populus trichocarpa (black cottonwood) ptc-miR396b
    33. Rosa chinensis ath-miR396a-5p
    34. Saccharum officinarum sof-miR396
    35. Saccharum sp. ssp-miR396
    36. Salvia sclarea (clary) ssl-miR396
    37. Solanum lycopersicum (tomato) sly-miR396a-5p
    38. Sorghum bicolor sbi-miR396a
    39. Theobroma cacao (cacao) tcc-miR396b
    40. Vitis vinifera (wine grape) vvi-miR396c
    41. Zea mays zma-miR396b-5p