Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays zma-miR396a-5p URS000039FDDC_4577

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Zea mays. Annotated by 3 databases (RefSeq, ENA, miRBase). Zea mays zma-miR396a-5p sequence is a product of zma-miR396a-5p, MIR396a, zma-miR396b-5p, zma-miR396a, miR396b, miR396a, MIR396b, miR396a-5p, miR396b-5p, zma-miR396b, miR396 genes. Found in the Zea mays reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUCCACAGCUUUCUUGAACUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 41 other species

    1. Acacia auriculiformis aau-miR396
    2. Acacia mangium amg-miR396
    3. Aegilops tauschii ata-miR396e-5p
    4. Ananas comosus (pineapple) vvi-miR396d
    5. Aquilegia coerulea aqc-miR396a
    6. Arabidopsis lyrata aly-miR396a-5p
    7. Arabidopsis thaliana ath-miR396a-5p
    8. Asparagus officinalis aof-miR396b
    9. Brachypodium distachyon bdi-miR396c-5p
    10. Bruguiera cylindrica bcy-miR396a
    11. Bruguiera gymnorhiza bgy-miR396a
    12. Camelina sativa (false flax) cas-miR396a
    13. Carica papaya (papaya) cpa-miR396
    14. Citrus sinensis (sweet orange) csi-miR396a-5p
    15. Cucumis melo cme-miR396b
    16. Digitalis purpurea dpr-miR396
    17. Eugenia uniflora eun-miR396b-5p
    18. Fragaria vesca subsp. vesca fve-miR396c-5p
    19. Glycine max (soybean) gma-miR396i-5p
    20. Gossypium hirsutum (cotton) ghr-miR396b
    21. Helianthus annuus ath-miR396a-5p
    22. Hevea brasiliensis (rubber tree) hbr-miR396b
    23. Linum usitatissimum lus-miR396c
    24. Lotus japonicus lja-miR396
    25. Malus domestica (apple) mdm-miR396b
    26. Manihot esculenta mes-miR396a
    27. Medicago truncatula mtr-miR396b-5p
    28. Nicotiana attenuata microRNA mir-396-like
    29. Nicotiana tabacum nta-miR396a
    30. Oryza sativa Japonica Group microRNA osa-miR396b-5p
    31. Oryza sativa (rice) osa-miR396a-5p
    32. Populus tomentosa Pto-miR396b
    33. Populus trichocarpa ptc-miR396a
    34. Rosa chinensis ath-miR396a-5p
    35. Saccharum officinarum sof-miR396
    36. Saccharum sp. ssp-miR396
    37. Salvia sclarea ssl-miR396
    38. Solanum lycopersicum (tomato) sly-miR396a-5p
    39. Sorghum bicolor sbi-miR396a
    40. Theobroma cacao (cacao) tcc-miR396a
    41. Vitis vinifera vvi-miR396d
    Publications New