Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR396b-5p URS000039FDDC_39947

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Described in 1 paper. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR396b-5p sequence is a product of osa-miR396b-5p, miR396, osa-miR396a, osa-miR396b, miR396b-5p, miR396a, osa-miR396a-5p, miR396b, miR396a-5p genes. Found in the japanese rice reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUCCACAGCUUUCUUGAACUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Acacia auriculiformis aau-miR396
    2. Acacia mangium amg-miR396
    3. Aegilops tauschii ata-miR396e-5p
    4. Ananas comosus (pineapple) vvi-miR396d
    5. Aquilegia coerulea aqc-miR396a
    6. Arabidopsis lyrata aly-miR396a-5p
    7. Arabidopsis thaliana ath-miR396a-5p
    8. Asparagus officinalis aof-miR396b
    9. Brachypodium distachyon bdi-miR396c-5p
    10. Bruguiera cylindrica bcy-miR396a
    11. Bruguiera gymnorhiza bgy-miR396a
    12. Camelina sativa (false flax) cas-miR396a
    13. Carica papaya (papaya) cpa-miR396
    14. Citrus sinensis csi-miR396a-5p
    15. Cucumis melo (muskmelon) cme-miR396b
    16. Digitalis purpurea dpr-miR396
    17. Eugenia uniflora eun-miR396b-5p
    18. Fragaria vesca subsp. vesca fve-miR396c-5p
    19. Glycine max gma-miR396a-5p
    20. Gossypium hirsutum (cotton) ghr-miR396a
    21. Helianthus annuus sRNA HannXRQ_Chr06g0181735
    22. Hevea brasiliensis hbr-miR396b
    23. Linum usitatissimum (flax) lus-miR396c
    24. Lotus japonicus lja-miR396
    25. Malus domestica mdm-miR396b
    26. Manihot esculenta mes-miR396b
    27. Medicago truncatula (barrel medic) mtr-miR396b-5p
    28. Nicotiana attenuata microRNA mir-396-like
    29. Nicotiana tabacum (common tobacco) nta-miR396a
    30. Oryza sativa osa-miR396a-5p
    31. Populus tomentosa Pto-miR396b
    32. Populus trichocarpa (black cottonwood) ptc-miR396b
    33. Rosa chinensis ath-miR396a-5p
    34. Saccharum officinarum sof-miR396
    35. Saccharum sp. ssp-miR396
    36. Salvia sclarea (clary) ssl-miR396
    37. Solanum lycopersicum sly-miR396a-5p
    38. Sorghum bicolor (sorghum) sbi-miR396b
    39. Theobroma cacao (cacao) tcc-miR396b
    40. Vitis vinifera vvi-miR396d
    41. Zea mays zma-miR396b-5p