Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Medicago truncatula (barrel medic) mtr-miR396b-5p URS000039FDDC_3880

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Medicago truncatula. Annotated by 1 database (miRBase). Found in the Medicago truncatula reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUCCACAGCUUUCUUGAACUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 41 other species

    1. Acacia auriculiformis aau-miR396
    2. Acacia mangium amg-miR396
    3. Aegilops tauschii ata-miR396e-5p
    4. Ananas comosus (pineapple) vvi-miR396d
    5. Aquilegia coerulea aqc-miR396a
    6. Arabidopsis lyrata aly-miR396a-5p
    7. Arabidopsis thaliana (thale cress) ath-miR396a-5p
    8. Asparagus officinalis (garden asparagus) aof-miR396b
    9. Brachypodium distachyon (stiff brome) bdi-miR396d-5p
    10. Bruguiera cylindrica bcy-miR396a
    11. Bruguiera gymnorhiza bgy-miR396a
    12. Camelina sativa cas-miR396a
    13. Carica papaya cpa-miR396
    14. Citrus sinensis (sweet orange) csi-miR396a-5p
    15. Cucumis melo (muskmelon) cme-miR396b
    16. Digitalis purpurea dpr-miR396
    17. Eugenia uniflora eun-miR396b-5p
    18. Fragaria vesca subsp. vesca fve-miR396a-5p
    19. Glycine max (soybean) gma-miR396i-5p
    20. Gossypium hirsutum (cotton) ghr-miR396b
    21. Helianthus annuus ath-miR396a-5p
    22. Hevea brasiliensis hbr-miR396b
    23. Linum usitatissimum lus-miR396c
    24. Lotus japonicus lja-miR396
    25. Malus domestica mdm-miR396b
    26. Manihot esculenta mes-miR396b
    27. Nicotiana attenuata microRNA mir-396-like
    28. Nicotiana tabacum nta-miR396a
    29. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR396b-5p
    30. Oryza sativa (rice) osa-miR396a-5p
    31. Populus tomentosa Pto-miR396b
    32. Populus trichocarpa ptc-miR396b
    33. Rosa chinensis ath-miR396a-5p
    34. Saccharum officinarum sof-miR396
    35. Saccharum sp. ssp-miR396
    36. Salvia sclarea ssl-miR396
    37. Solanum lycopersicum (tomato) sly-miR396a-5p
    38. Sorghum bicolor (sorghum) sbi-miR396b
    39. Theobroma cacao (cacao) tcc-miR396b
    40. Vitis vinifera (wine grape) vvi-miR396d
    41. Zea mays zma-miR396b-5p
    Publications