Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-21a-5p URS000039ED8D_10090

mRNA interactions 11 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCUUAUCAGACUGAUGUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Anolis carolinensis aca-miR-21-5p
  2. Ateles geoffroyi age-miR-21
  3. Bos taurus microRNA miR-21
  4. Callithrix jacchus cja-miR-21
  5. Canis lupus familiaris (dog) cfa-miR-21
  6. Capra hircus (goat) miR-21
  7. Chrysemys picta cpi-miR-21-5p
  8. Columba livia cli-miR-21-5p
  9. Cricetulus griseus cgr-miR-21-5p
  10. Equus caballus eca-miR-21
  11. Gallus gallus gga-miR-21-5p
  12. Gorilla gorilla gorilla ggo-miR-21 (MIR21)
  13. Gorilla gorilla (western gorilla) ggo-miR-21
  14. Homo sapiens hsa-miR-21-5p
  15. Macaca mulatta mml-miR-21-5p
  16. Macaca nemestrina mne-miR-21
  17. Monodelphis domestica (gray short-tailed opossum) mdo-miR-21-5p
  18. Ophiophagus hannah oha-miR-21-5p
  19. Ornithorhynchus anatinus oan-miR-21-5p
  20. Ovis aries (sheep) microRNA miR-21
  21. Pan paniscus ppa-miR-21
  22. Pan troglodytes ptr-miR-21
  23. Pongo pygmaeus (Bornean orangutan) ppy-miR-21
  24. Pteropus alecto pal-miR-21-5p
  25. Rattus norvegicus rno-miR-21-5p
  26. Sus scrofa ssc-miR-21-5p
  27. Taeniopygia guttata (zebra finch) tgu-miR-21-5p
  28. Tupaia chinensis tch-miR-21-5p
  29. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-2544792
Publications