Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-21-5p URS000039ED8D_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (MalaCards, PSICQUIC, RefSeq, IntAct, GeneCards, ENA, TarBase, miRBase, LncBase). Described in 176 papers. Homo sapiens (human) hsa-miR-21-5p sequence is a product of miR-21, hsa-miR-21-5p, miR-21-5p, hsa-miR-21, 21, MIR21 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 15.5K, 156DAG, 182-FIP, 1A1-3B, 1R20, 20D7-FC4, 2PP2A, 3-10C, 3-PAP, 30ST3B1.

Interactions 268

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-21-5p interacts with:

Interaction id Participant Synonyms
EBI-22267582 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
EBI-20768309 intact:EBI-20738906 EBI-20738906 ENST00000377966.3 mrna_reck
URS000039ED8D_9606-141 O00206 O00206
URS000039ED8D_9606-0 O00206 O00206
URS000039ED8D_9606-143 O00712 O00712
URS000039ED8D_9606-1 O00712 O00712
URS000039ED8D_9606-142 O00712 O00712
URS000039ED8D_9606-128 O00712 O00712
URS000039ED8D_9606-129 O14519 O14519
URS000039ED8D_9606-144 O14519 O14519
URS000039ED8D_9606-2 O14727 O14727
URS000039ED8D_9606-145 O14727 O14727
URS000039ED8D_9606-3 O14763 O14763
URS000039ED8D_9606-146 O14763 O14763
URS000039ED8D_9606-147 O15105 O15105
URS000039ED8D_9606-4 O15105 O15105
URS000039ED8D_9606-5 O15105 O15105
URS000039ED8D_9606-6 O15528 O15528
URS000039ED8D_9606-148 O15528 O15528
URS000039ED8D_9606-149 O43597 O43597
URS000039ED8D_9606-7 O43597 O43597
URS000039ED8D_9606-8 O43597 O43597
URS000039ED8D_9606-150 O43609 O43609
URS000039ED8D_9606-9 O43609 O43609
URS000039ED8D_9606-10 O43609 O43609
URS000039ED8D_9606-11 O43670 O43670
URS000039ED8D_9606-151 O43670 O43670
URS000039ED8D_9606-152 O60308 O60308
URS000039ED8D_9606-12 O60308 O60308
URS000039ED8D_9606-153 O60568 O60568
URS000039ED8D_9606-13 O60568 O60568
URS000039ED8D_9606-154 O94760 O94760
URS000039ED8D_9606-14 O94760 O94760
URS000039ED8D_9606-15 O95267 O95267
URS000039ED8D_9606-155 O95267 O95267
URS000039ED8D_9606-16 O95376 O95376
URS000039ED8D_9606-156 O95376 O95376
URS000039ED8D_9606-17 O95980 O95980
URS000039ED8D_9606-157 O95980 O95980
URS000039ED8D_9606-18 O95980 O95980
URS000039ED8D_9606-158 P00750 P00750
URS000039ED8D_9606-19 P00750 P00750
URS000039ED8D_9606-20 P01375 P01375
URS000039ED8D_9606-159 P01375 P01375
URS000039ED8D_9606-160 P01584 P01584
URS000039ED8D_9606-22 P01584 P01584
URS000039ED8D_9606-161 P01584 P01584
URS000039ED8D_9606-21 P01584 P01584
URS000039ED8D_9606-162 P02462 P02462
URS000039ED8D_9606-23 P02462 P02462
URS000039ED8D_9606-163 P05362 P05362
URS000039ED8D_9606-24 P05362 P05362
URS000039ED8D_9606-130 P08047 P08047
URS000039ED8D_9606-164 P08047 P08047
URS000039ED8D_9606-165 P08294 P08294
URS000039ED8D_9606-25 P08294 P08294
URS000039ED8D_9606-131 P09493 P09493
URS000039ED8D_9606-26 P09493 P09493
URS000039ED8D_9606-166 P09493 P09493
URS000039ED8D_9606-168 P09493 P09493
URS000039ED8D_9606-167 P09493 P09493
URS000039ED8D_9606-132 P09493 P09493
URS000039ED8D_9606-27 P0C6A0 P0C6A0
URS000039ED8D_9606-169 P0C6A0 P0C6A0
URS000039ED8D_9606-170 P10909 P10909
URS000039ED8D_9606-28 P10909 P10909
URS000039ED8D_9606-29 P15428 P15428
URS000039ED8D_9606-171 P15428 P15428
URS000039ED8D_9606-172 P19793 P19793
URS000039ED8D_9606-30 P19793 P19793
URS000039ED8D_9606-32 P29459 P29459
URS000039ED8D_9606-174 P29459 P29459
URS000039ED8D_9606-31 P29459 P29459
URS000039ED8D_9606-173 P29459 P29459
URS000039ED8D_9606-33 P29966 P29966
URS000039ED8D_9606-175 P29966 P29966
URS000039ED8D_9606-176 P30304 P30304
URS000039ED8D_9606-34 P30304 P30304
URS000039ED8D_9606-35 P30304 P30304
URS000039ED8D_9606-177 P30304 P30304
URS000039ED8D_9606-178 P30405 P30405
URS000039ED8D_9606-36 P30405 P30405
URS000039ED8D_9606-37 P35625 P35625
URS000039ED8D_9606-179 P35625 P35625
URS000039ED8D_9606-180 P35711 P35711
URS000039ED8D_9606-38 P35711 P35711
URS000039ED8D_9606-39 P36952 P36952
URS000039ED8D_9606-40 P36952 P36952
URS000039ED8D_9606-181 P36952 P36952
URS000039ED8D_9606-182 P36952 P36952
URS000039ED8D_9606-184 P37173 P37173
URS000039ED8D_9606-183 P37173 P37173
URS000039ED8D_9606-41 P37173 P37173
URS000039ED8D_9606-42 P37173 P37173
URS000039ED8D_9606-185 P37231 P37231
URS000039ED8D_9606-43 P37231 P37231
URS000039ED8D_9606-186 P39687 P39687
URS000039ED8D_9606-44 P39687 P39687
URS000039ED8D_9606-45 P40337 P40337
URS000039ED8D_9606-187 P40337 P40337
URS000039ED8D_9606-46 P43026 P43026
URS000039ED8D_9606-188 P43026 P43026
URS000039ED8D_9606-133 P43246 P43246
URS000039ED8D_9606-189 P43246 P43246
URS000039ED8D_9606-190 P46734 P46734
URS000039ED8D_9606-191 P46734 P46734
URS000039ED8D_9606-48 P46734 P46734
URS000039ED8D_9606-47 P46734 P46734
URS000039ED8D_9606-51 P48023 P48023
URS000039ED8D_9606-192 P48023 P48023
URS000039ED8D_9606-193 P48023 P48023
URS000039ED8D_9606-194 P48023 P48023
URS000039ED8D_9606-49 P48023 P48023
URS000039ED8D_9606-50 P48023 P48023
URS000039ED8D_9606-52 P51532 P51532
URS000039ED8D_9606-195 P51532 P51532
URS000039ED8D_9606-53 P51617 P51617
URS000039ED8D_9606-196 P51617 P51617
URS000039ED8D_9606-54 P51815 P51815
URS000039ED8D_9606-197 P51815 P51815
URS000039ED8D_9606-198 P52701 P52701
URS000039ED8D_9606-134 P52701 P52701
URS000039ED8D_9606-55 P60484 P60484
URS000039ED8D_9606-199 P60484 P60484
URS000039ED8D_9606-200 P60484 P60484
URS000039ED8D_9606-58 P60484 P60484
URS000039ED8D_9606-56 P60484 P60484
URS000039ED8D_9606-57 P60484 P60484
URS000039ED8D_9606-59 P61978 P61978
URS000039ED8D_9606-201 P61978 P61978
URS000039ED8D_9606-61 P62745 P62745
URS000039ED8D_9606-202 P62745 P62745
URS000039ED8D_9606-60 P62745 P62745
URS000039ED8D_9606-203 P62745 P62745
URS000039ED8D_9606-204 P78504 P78504
URS000039ED8D_9606-62 P78504 P78504
URS000039ED8D_9606-205 P78543 P78543
URS000039ED8D_9606-63 P78543 P78543
URS000039ED8D_9606-206 P78556 P78556
URS000039ED8D_9606-64 P78556 P78556
URS000039ED8D_9606-207 P80723 P80723
URS000039ED8D_9606-65 P80723 P80723
URS000039ED8D_9606-208 Q03167 Q03167
URS000039ED8D_9606-66 Q03167 Q03167
URS000039ED8D_9606-67 Q06413 Q06413
URS000039ED8D_9606-209 Q06413 Q06413
URS000039ED8D_9606-69 Q07869 Q07869
URS000039ED8D_9606-135 Q07869 Q07869
URS000039ED8D_9606-136 Q07869 Q07869
URS000039ED8D_9606-137 Q07869 Q07869
URS000039ED8D_9606-210 Q07869 Q07869
URS000039ED8D_9606-211 Q07869 Q07869
URS000039ED8D_9606-212 Q07869 Q07869
URS000039ED8D_9606-213 Q07869 Q07869
URS000039ED8D_9606-68 Q07869 Q07869
URS000039ED8D_9606-214 Q08289 Q08289
URS000039ED8D_9606-70 Q08289 Q08289
URS000039ED8D_9606-216 Q13009 Q13009
URS000039ED8D_9606-138 Q13009 Q13009
URS000039ED8D_9606-215 Q13009 Q13009
URS000039ED8D_9606-71 Q13009 Q13009
URS000039ED8D_9606-72 Q13126 Q13126
URS000039ED8D_9606-217 Q13126 Q13126
URS000039ED8D_9606-73 Q13625 Q13625
URS000039ED8D_9606-218 Q13625 Q13625
URS000039ED8D_9606-74 Q13873 Q13873
URS000039ED8D_9606-219 Q13873 Q13873
URS000039ED8D_9606-220 Q13936 Q13936
URS000039ED8D_9606-75 Q13936 Q13936
URS000039ED8D_9606-76 Q14185 Q14185
URS000039ED8D_9606-221 Q14185 Q14185
URS000039ED8D_9606-77 Q14240 Q14240
URS000039ED8D_9606-78 Q15365 Q15365
URS000039ED8D_9606-222 Q15365 Q15365
URS000039ED8D_9606-79 Q15582 Q15582
URS000039ED8D_9606-80 Q32MZ4 Q32MZ4
URS000039ED8D_9606-223 Q32MZ4 Q32MZ4
URS000039ED8D_9606-224 Q3V6T2 Q3V6T2
URS000039ED8D_9606-81 Q3V6T2 Q3V6T2
URS000039ED8D_9606-232 Q53EL6 Q53EL6
URS000039ED8D_9606-89 Q53EL6 Q53EL6
URS000039ED8D_9606-88 Q53EL6 Q53EL6
URS000039ED8D_9606-87 Q53EL6 Q53EL6
URS000039ED8D_9606-86 Q53EL6 Q53EL6
URS000039ED8D_9606-85 Q53EL6 Q53EL6
URS000039ED8D_9606-231 Q53EL6 Q53EL6
URS000039ED8D_9606-230 Q53EL6 Q53EL6
URS000039ED8D_9606-140 Q53EL6 Q53EL6
URS000039ED8D_9606-228 Q53EL6 Q53EL6
URS000039ED8D_9606-227 Q53EL6 Q53EL6
URS000039ED8D_9606-226 Q53EL6 Q53EL6
URS000039ED8D_9606-225 Q53EL6 Q53EL6
URS000039ED8D_9606-84 Q53EL6 Q53EL6
URS000039ED8D_9606-82 Q53EL6 Q53EL6
URS000039ED8D_9606-229 Q53EL6 Q53EL6
URS000039ED8D_9606-139 Q53EL6 Q53EL6
URS000039ED8D_9606-92 Q53EL6 Q53EL6
URS000039ED8D_9606-91 Q53EL6 Q53EL6
URS000039ED8D_9606-90 Q53EL6 Q53EL6
URS000039ED8D_9606-83 Q53EL6 Q53EL6
URS000039ED8D_9606-233 Q567U6 Q567U6
URS000039ED8D_9606-93 Q567U6 Q567U6
URS000039ED8D_9606-94 Q5JSL3 Q5JSL3
URS000039ED8D_9606-234 Q5JSL3 Q5JSL3
URS000039ED8D_9606-95 Q5TAA0 Q5TAA0
URS000039ED8D_9606-235 Q5TAA0 Q5TAA0
URS000039ED8D_9606-96 Q86W74 Q86W74
URS000039ED8D_9606-236 Q86W74 Q86W74
URS000039ED8D_9606-237 Q8IXQ6 Q8IXQ6
URS000039ED8D_9606-97 Q8IXQ6 Q8IXQ6
URS000039ED8D_9606-99 Q8N1I0 Q8N1I0
URS000039ED8D_9606-238 Q8N1I0 Q8N1I0
URS000039ED8D_9606-98 Q8N1I0 Q8N1I0
URS000039ED8D_9606-239 Q8N9B5 Q8N9B5
URS000039ED8D_9606-100 Q8N9B5 Q8N9B5
URS000039ED8D_9606-240 Q8TCE9 Q8TCE9
URS000039ED8D_9606-101 Q8TCE9 Q8TCE9
URS000039ED8D_9606-241 Q8WW59 Q8WW59
URS000039ED8D_9606-102 Q8WW59 Q8WW59
URS000039ED8D_9606-242 Q8WZ73 Q8WZ73
URS000039ED8D_9606-103 Q8WZ73 Q8WZ73
URS000039ED8D_9606-104 Q92896 Q92896
URS000039ED8D_9606-243 Q92896 Q92896
URS000039ED8D_9606-244 Q96BY6 Q96BY6
URS000039ED8D_9606-105 Q96BY6 Q96BY6
URS000039ED8D_9606-106 Q96HP0 Q96HP0
URS000039ED8D_9606-245 Q96HP0 Q96HP0
URS000039ED8D_9606-107 Q96N67 Q96N67
URS000039ED8D_9606-246 Q96N67 Q96N67
URS000039ED8D_9606-108 Q99836 Q99836
URS000039ED8D_9606-247 Q99836 Q99836
URS000039ED8D_9606-109 Q9BPX3 Q9BPX3
URS000039ED8D_9606-248 Q9BPX3 Q9BPX3
URS000039ED8D_9606-249 Q9BUN8 Q9BUN8
URS000039ED8D_9606-110 Q9BUN8 Q9BUN8
URS000039ED8D_9606-111 Q9BXT8 Q9BXT8
URS000039ED8D_9606-250 Q9BXT8 Q9BXT8
URS000039ED8D_9606-251 Q9BZ29 Q9BZ29
URS000039ED8D_9606-112 Q9BZ29 Q9BZ29
URS000039ED8D_9606-113 Q9H3D4 Q9H3D4
URS000039ED8D_9606-252 Q9H3D4 Q9H3D4
URS000039ED8D_9606-115 Q9H7D0 Q9H7D0
URS000039ED8D_9606-114 Q9H7D0 Q9H7D0
URS000039ED8D_9606-253 Q9H7D0 Q9H7D0
URS000039ED8D_9606-254 Q9HAI6 Q9HAI6
URS000039ED8D_9606-116 Q9HAI6 Q9HAI6
URS000039ED8D_9606-117 Q9HAP2 Q9HAP2
URS000039ED8D_9606-255 Q9HAP2 Q9HAP2
URS000039ED8D_9606-118 Q9HBE4 Q9HBE4
URS000039ED8D_9606-256 Q9HBE4 Q9HBE4
URS000039ED8D_9606-119 Q9NQC3 Q9NQC3
URS000039ED8D_9606-257 Q9NQC3 Q9NQC3
URS000039ED8D_9606-259 Q9NS56 Q9NS56
URS000039ED8D_9606-258 Q9NS56 Q9NS56
URS000039ED8D_9606-120 Q9NS56 Q9NS56
URS000039ED8D_9606-121 Q9NS56 Q9NS56
URS000039ED8D_9606-122 Q9NX95 Q9NX95
URS000039ED8D_9606-260 Q9NX95 Q9NX95
URS000039ED8D_9606-123 Q9P0K1 Q9P0K1
URS000039ED8D_9606-261 Q9P0K1 Q9P0K1
URS000039ED8D_9606-262 Q9UER7 Q9UER7
URS000039ED8D_9606-124 Q9UER7 Q9UER7
URS000039ED8D_9606-125 Q9UKU0 Q9UKU0
URS000039ED8D_9606-263 Q9UKU0 Q9UKU0
URS000039ED8D_9606-264 Q9Y6W6 Q9Y6W6
URS000039ED8D_9606-126 Q9Y6W6 Q9Y6W6
URS000039ED8D_9606-265 Q9Y6X2 Q9Y6X2
URS000039ED8D_9606-127 Q9Y6X2 Q9Y6X2

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCUUAUCAGACUGAUGUUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 43 other species

    1. Anolis carolinensis aca-miR-21-5p
    2. Ateles geoffroyi (black-handed spider monkey) age-miR-21
    3. Bos taurus (cattle) microRNA miR-21
    4. Callithrix jacchus cja-miR-21
    5. Canis lupus familiaris cfa-miR-21
    6. Capra hircus miR-21
    7. Chrysemys picta (Painted turtle) cpi-miR-21-5p
    8. Columba livia (rock pigeon) cli-miR-21-5p
    9. Cricetulus griseus cgr-miR-21-5p
    10. Equus caballus (horse) eca-miR-21
    11. Gallus gallus (chicken) gga-miR-21-5p
    12. Gorilla gorilla (western gorilla) ggo-miR-21
    13. Macaca mulatta mml-miR-21-5p
    14. Macaca nemestrina (pig-tailed macaque) mne-miR-21
    15. Monodelphis domestica mdo-miR-21-5p
    16. Mus musculus (house mouse) mmu-miR-21a-5p
    17. Ophiophagus hannah oha-miR-21-5p
    18. Ornithorhynchus anatinus oan-miR-21-5p
    19. Ovis aries microRNA miR-21
    20. Pan paniscus ppa-miR-21
    21. Pan troglodytes (chimpanzee) ptr-miR-21
    22. Pongo pygmaeus ppy-miR-21
    23. Pteropus alecto pal-miR-21-5p
    24. Rattus norvegicus rno-miR-21-5p
    25. Sus scrofa ssc-miR-21-5p
    26. Taeniopygia guttata (zebra finch) tgu-miR-21-5p
    27. Tupaia chinensis tch-miR-21-5p
    28. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2544792