Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-21 URS000039ED8D_9598

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Pan troglodytes. Annotated by 3 databases (RefSeq, ENA, miRBase). Pan troglodytes (chimpanzee) ptr-miR-21 sequence is a product of mir-21, ptr-miR-21, miR-21, MIR21, 21 genes. Found in the chimpanzee reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGCUUAUCAGACUGAUGUUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Anolis carolinensis (green anole) aca-miR-21-5p
    2. Ateles geoffroyi age-miR-21
    3. Bos taurus microRNA miR-21
    4. Callithrix jacchus cja-miR-21
    5. Canis lupus familiaris (dog) cfa-miR-21
    6. Capra hircus miR-21
    7. Chrysemys picta cpi-miR-21-5p
    8. Columba livia (rock pigeon) cli-miR-21-5p
    9. Cricetulus griseus (Chinese hamster) cgr-miR-21-5p
    10. Equus caballus eca-miR-21
    11. Gallus gallus gga-miR-21-5p
    12. Gorilla gorilla ggo-miR-21
    13. Homo sapiens (human) hsa-miR-21-5p
    14. Macaca mulatta (Rhesus monkey) mml-miR-21-5p
    15. Macaca nemestrina (pig-tailed macaque) mne-miR-21
    16. Monodelphis domestica mdo-miR-21-5p
    17. Mus musculus (house mouse) mmu-miR-21a-5p
    18. Ophiophagus hannah oha-miR-21-5p
    19. Ornithorhynchus anatinus oan-miR-21-5p
    20. Ovis aries microRNA miR-21
    21. Pan paniscus ppa-miR-21
    22. Pongo pygmaeus ppy-miR-21
    23. Pteropus alecto (black flying fox) pal-miR-21-5p
    24. Rattus norvegicus (Norway rat) rno-miR-21-5p
    25. Sus scrofa (pig) ssc-miR-21-5p
    26. Taeniopygia guttata (zebra finch) tgu-miR-21-5p
    27. Tupaia chinensis tch-miR-21-5p
    28. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2544792
    Publications New