Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-21-5p URS000039ED8D_9544

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Macaca mulatta. Annotated by 3 databases (RefSeq, miRBase, ENA). Described in 5 papers. Macaca mulatta (Rhesus monkey) mml-miR-21-5p sequence is a product of mml-miR-21, miR-21, miR-21-5p, 21, mml-miR-21-5p, MIR21, mir-21 genes. Found in the rhesus monkey reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCUUAUCAGACUGAUGUUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 43 other species

    1. Anolis carolinensis aca-miR-21-5p
    2. Ateles geoffroyi (black-handed spider monkey) age-miR-21
    3. Bos taurus (cattle) microRNA miR-21
    4. Callithrix jacchus cja-miR-21
    5. Canis lupus familiaris cfa-miR-21
    6. Capra hircus miR-21
    7. Chrysemys picta (Painted turtle) cpi-miR-21-5p
    8. Columba livia (rock pigeon) cli-miR-21-5p
    9. Cricetulus griseus cgr-miR-21-5p
    10. Equus caballus (horse) eca-miR-21
    11. Gallus gallus (chicken) gga-miR-21-5p
    12. Gorilla gorilla (western gorilla) ggo-miR-21
    13. Homo sapiens hsa-miR-21-5p
    14. Macaca nemestrina (pig-tailed macaque) mne-miR-21
    15. Monodelphis domestica mdo-miR-21-5p
    16. Mus musculus (house mouse) mmu-miR-21a-5p
    17. Ophiophagus hannah oha-miR-21-5p
    18. Ornithorhynchus anatinus oan-miR-21-5p
    19. Ovis aries microRNA miR-21
    20. Pan paniscus ppa-miR-21
    21. Pan troglodytes (chimpanzee) ptr-miR-21
    22. Pongo pygmaeus ppy-miR-21
    23. Pteropus alecto pal-miR-21-5p
    24. Rattus norvegicus rno-miR-21-5p
    25. Sus scrofa ssc-miR-21-5p
    26. Taeniopygia guttata (zebra finch) tgu-miR-21-5p
    27. Tupaia chinensis tch-miR-21-5p
    28. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2544792