Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-130a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-130a precursor URS000039E12D_9606

  • 89 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 26 species

Automated summary: This pre miRNA sequence is 89 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (miRBase, HGNC, Ensembl/GENCODE, ENA, Ensembl, MalaCards, RefSeq, GeneCards). Described in 51 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-130, RF00258). Homo sapiens (human) microRNA hsa-mir-130a precursor sequence is a product of mir-130a, mir-130a precurso, mir-130a precursor, hsa-mir-130a precursor, MIR130A genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGCUGCUGGCCAGAGCUCUUUUCACAUUGUGCUACUGUCUGCACCUGUCACUAGCAGUGCAAUGUUAAAAGGGCAUUGGCCGUGUAGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 25 other species

    1. Aotus nancymaae miRNA
    2. Callithrix jacchus miRNA
    3. Carlito syrichta (Philippine tarsier) miRNA
    4. Cercocebus atys (Sooty mangabey) miRNA
    5. Chlorocebus sabaeus (African green monkey) miRNA
    6. Colobus angolensis palliatus miRNA
    7. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-130a
    8. Gorilla gorilla microRNA ggo-mir-130a precursor
    9. Macaca fascicularis miRNA
    10. Macaca mulatta mml-mir-130a
    11. Macaca nemestrina microRNA mne-mir-130a precursor
    12. Mandrillus leucophaeus (Drill) miRNA
    13. Microcebus murinus miRNA
    14. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    15. Otolemur garnettii (small-eared galago) miRNA
    16. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-130a precursor
    17. Pan troglodytes (chimpanzee) ptr-mir-130a
    18. Papio anubis (Olive baboon) miRNA
    19. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA
    20. Pongo abelii microRNA 130a
    21. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-130a precursor
    22. Prolemur simus miRNA
    23. Propithecus coquereli (Coquerel's sifaka) miRNA
    24. Rhinopithecus bieti miRNA
    25. Rhinopithecus roxellana miRNA
    26. Theropithecus gelada microRNA 130a
    2D structure New