Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gossypium hirsutum (cotton) ghr-miR393 URS000039C9E6_3635

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAAAGGGAUCGCAUUGAUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Ananas comosus microRNA 393c
  2. Asparagus officinalis aof-miR393b
  3. Fragaria vesca subsp. vesca fve-miR393b
  4. Malus domestica (apple) mdm-miR393b
  5. Manihot esculenta mes-miR393d
  6. Oryza sativa (Asian cultivated rice) osa-miR393b-5p
  7. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR393b-5p
  8. Prunus persica microRNA miRNA_293
  9. Rosa chinensis osa-miR393b-5p
  10. Zea mays (maize) zma-miR393a-5p
Publications