Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000012338.1) secondary structure diagram

Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000012338.1) URS000039AE8A_9568

Automated summary: This pre miRNA sequence is 110 nucleotides long and is found in Mandrillus leucophaeus. Annotated by 1 database (Ensembl). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-204, RF00646). Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000012338.1) sequence is a product of ENSMLEG00000012338.1 gene. Found in the drill reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GGCUACAGUCUUUCUUCAUGUGACUCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAUGAAGGAGGCUGGGAAGGCAAAGGGACGUUCAAUUGUCAUCACUGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 60 other species

    1. Ailuropoda melanoleuca (giant panda) microRNA 204 (ENSAMEG00000022692.2)
    2. Aotus nancymaae miRNA (ENSANAG00000003167.1)
    3. Balaenoptera musculus microRNA 204 (ENSBMSG00010002918.1)
    4. Callithrix jacchus miRNA (ENSCJAG00000024032.3)
    5. Camelus dromedarius microRNA 204 (ENSCDRG00005001797.1)
    6. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000022736.2)
    7. Castor canadensis (American beaver) miRNA (ENSCCNG00000018566.1)
    8. Colobus angolensis palliatus miRNA (ENSCANG00000002663.1)
    9. Delphinapterus leucas (beluga whale) microRNA 204 (ENSDLEG00000009637.1)
    10. Equus asinus asinus microRNA 204 (ENSEASG00005009596.1)
    11. Equus caballus miRNA (ENSECAG00000028185.1, ENSECAG00000030779.1)
    12. Felis catus (domestic cat) microRNA 204 (ENSFCAG00000022005.3)
    13. Gorilla gorilla gorilla ggo-mir-204 (ENSGGOG00000030597.2)
    14. Gorilla gorilla microRNA ggo-mir-204 precursor
    15. Homo sapiens (human) microRNA hsa-mir-204 precursor
    16. Lynx canadensis microRNA 204 (ENSLCNG00005018584.1)
    17. Macaca fascicularis (Crab-eating macaque) miRNA
    18. Macaca mulatta (Rhesus monkey) microRNA mml-mir-204 precursor
    19. Macaca nemestrina microRNA mne-mir-204 precursor
    20. Marmota marmota marmota (Alpine marmot) microRNA 204 (ENSMMMG00000011680.1)
    21. Monodon monoceros microRNA 204 (ENSMMNG00015014225.1)
    22. Myotis lucifugus (little brown bat) microRNA 204 (ENSMLUG00000018067.1)
    23. Neogale vison microRNA 204 (ENSNVIG00000011215.1)
    24. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000020361.1)
    25. Pan paniscus microRNA ppa-mir-204 precursor
    26. Panthera leo microRNA 204 (ENSPLOG00000012602.1)
    27. Panthera pardus (leopard) microRNA 204 (ENSPPRG00000014729.1)
    28. Panthera tigris altaica (Tiger) microRNA 204 (ENSPTIG00000001353.1)
    29. Pan troglodytes microRNA ptr-mir-204 precursor
    30. Papio anubis miRNA (ENSPANG00000002477.3)
    31. Phocoena sinus (vaquita) microRNA 204 (ENSPSNG00000013012.1)
    32. Physeter catodon (sperm whale) microRNA 204 (ENSPCTG00005003483.1)
    33. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000039370.1)
    34. Pongo abelii microRNA 204 (ENSPPYG00000021764.2)
    35. Pongo pygmaeus microRNA ppy-mir-204 precursor
    36. Prolemur simus miRNA (ENSPSMG00000025833.1)
    37. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000009627.1)
    38. Pteropus vampyrus microRNA 204 (ENSPVAG00000025825.1)
    39. Rhinolophus ferrumequinum microRNA 204 (ENSRFEG00010009038.1)
    40. Rhinopithecus bieti miRNA (ENSRBIG00000007978.1)
    41. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000010056.1)
    42. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-204 precursor
    43. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000015965.1)
    44. Sciurus vulgaris (Eurasian red squirrel) microRNA 204 (ENSSVLG00005021758.1)
    45. Spermophilus dauricus (Daurian ground squirrel) miRNA (ENSSDAG00000007206.1)
    46. Suricata suricatta microRNA 204 (ENSSSUG00005015638.1)
    47. Theropithecus gelada (gelada) microRNA 204 (ENSTGEG00000025479.1)
    48. Tupaia belangeri (northern tree shrew) microRNA 204 (ENSTBEG00000017860.1)
    49. Urocitellus parryii miRNA (ENSUPAG00010023509.1)
    50. Ursus americanus microRNA 204 (ENSUAMG00000018544.1)
    51. Ursus maritimus microRNA 204 (ENSUMAG00000021930.1)
    52. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 204 (ENSUTTG00000008324.1)
    53. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015014798.1)
    2D structure