Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Castor canadensis (American beaver) miRNA (ENSCCNG00000018566.1) secondary structure diagram

Castor canadensis (American beaver) miRNA (ENSCCNG00000018566.1) URS000039AE8A_51338

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GGCUACAGUCUUUCUUCAUGUGACUCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAUGAAGGAGGCUGGGAAGGCAAAGGGACGUUCAAUUGUCAUCACUGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 60 other species

    1. Ailuropoda melanoleuca (giant panda) microRNA 204 (ENSAMEG00000022692.2)
    2. Aotus nancymaae miRNA (ENSANAG00000003167.1)
    3. Balaenoptera musculus (Blue whale) microRNA 204 (ENSBMSG00010002918.1)
    4. Callithrix jacchus miRNA (ENSCJAG00000024032.3)
    5. Camelus dromedarius (Arabian camel) microRNA 204 (ENSCDRG00005001797.1)
    6. Carlito syrichta miRNA (ENSTSYG00000022736.2)
    7. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000002663.1)
    8. Delphinapterus leucas (beluga whale) microRNA 204 (ENSDLEG00000009637.1)
    9. Equus asinus asinus microRNA 204 (ENSEASG00005009596.1)
    10. Equus caballus (horse) miRNA (ENSECAG00000028185.1, ENSECAG00000030779.1)
    11. Felis catus (domestic cat) miRNA (ENSFCAG00000022005.3)
    12. Gorilla gorilla gorilla ggo-mir-204 (ENSGGOG00000030597.2)
    13. Gorilla gorilla microRNA ggo-mir-204 precursor
    14. Homo sapiens microRNA hsa-mir-204 precursor
    15. Lynx canadensis microRNA 204 (ENSLCNG00005018584.1)
    16. Macaca mulatta microRNA mml-mir-204 precursor
    17. Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-204 precursor
    18. Mandrillus leucophaeus miRNA (ENSMLEG00000012338.1)
    19. Marmota marmota marmota (Alpine marmot) microRNA 204 (ENSMMMG00000011680.1)
    20. Monodon monoceros (narwhal) microRNA 204 (ENSMMNG00015014225.1)
    21. Myotis lucifugus microRNA 204 (ENSMLUG00000018067.1)
    22. Neogale vison microRNA 204 (ENSNVIG00000011215.1)
    23. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000020361.1)
    24. Pan paniscus microRNA ppa-mir-204 precursor
    25. Panthera leo (lion) miRNA MIR204 (ENSPLOG00000012602.1)
    26. Panthera pardus miRNA (ENSPPRG00000014729.1)
    27. Panthera tigris altaica (Tiger) miRNA MIR204 (ENSPTIG00000001353.1)
    28. Pan troglodytes (chimpanzee) microRNA ptr-mir-204 precursor
    29. Papio anubis miRNA (ENSPANG00000002477.3)
    30. Phocoena sinus (vaquita) microRNA 204 (ENSPSNG00000013012.1)
    31. Physeter catodon (sperm whale) microRNA 204 (ENSPCTG00005003483.1)
    32. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000039370.1)
    33. Pongo abelii microRNA 204 (ENSPPYG00000021764.2)
    34. Pongo pygmaeus microRNA ppy-mir-204 precursor
    35. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000025833.1)
    36. Propithecus coquereli miRNA (ENSPCOG00000009627.1)
    37. Pteropus vampyrus (large flying fox) microRNA 204 (ENSPVAG00000025825.1)
    38. Rhinolophus ferrumequinum microRNA 204 (ENSRFEG00010009038.1)
    39. Rhinopithecus bieti miRNA (ENSRBIG00000007978.1)
    40. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000010056.1)
    41. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-204 precursor
    42. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000015965.1)
    43. Sciurus vulgaris microRNA 204 (ENSSVLG00005021758.1)
    44. Spermophilus dauricus miRNA (ENSSDAG00000007206.1)
    45. Suricata suricatta (meerkat) microRNA 204 (ENSSSUG00005015638.1)
    46. Theropithecus gelada microRNA 204 (ENSTGEG00000025479.1)
    47. Tupaia belangeri microRNA 204 (ENSTBEG00000017860.1)
    48. Urocitellus parryii (Arctic ground squirrel) miRNA (ENSUPAG00010023509.1)
    49. Ursus americanus microRNA 204 (ENSUAMG00000018544.1)
    50. Ursus maritimus (Polar bear) microRNA 204 (ENSUMAG00000021930.1)
    51. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 204 (ENSUTTG00000008324.1)
    52. Zalophus californianus miRNA (ENSZCAG00015014798.1)
    53. Equus asinus None
    54. Cebus imitator None
    2D structure