Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-500a-5p URS000039A052_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-500a: Hsa-mir-500a is a pre-miRNA that encodes a microRNA. It is annotated to have its major arm as the 5p arm [PMC3303722]. Hsa-mir-500a has been found to be negatively associated with poor overall survival in pancreatic adenocarcinoma [PMC9158148]. It has also been identified as differentially expressed in painful and non-painful human lingual nerve neuromas, with reduced levels associated with the presence of pain [PMC6620726]. Hsa-mir-500a has been predicted to target genes involved in potassium channels, such as Kcna1 and Kcnj1 [PMC6620726]. Additionally, it has been associated with axon regeneration following injury and may contribute to the regulation of several potassium channels [PMC6620726]. Hsa-mir-500a has also been found to be differentially expressed in hepatocellular carcinoma and neuroblastoma, where its upregulation is associated with poor response to chemotherapy [PMC3521178] [PMC5609578]. Furthermore, it has been identified as one of the miRNAs that could predict gene expression regulation in prostate cancer [PMC8426106]. The inhibitory effect of hsa-mir-500a on gene expression was found to be stronger for the T allele compared to the C allele in HepG2 cells [PMC9692299]. Additionally, hsa-mir-500a was found to be differentially expressed between Black/AA and White/EA patients with triple-negative breast cancer and correlated with AR expression levels [PMC9497140].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUCCUUGCUACCUGGGUGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Bos taurus bta-miR-500
  2. Capra hircus (goat) chi-miR-500-5p
  3. Equus caballus eca-miR-500
  4. Macaca mulatta mml-miR-500b-5p
  5. Pan troglodytes ptr-miR-500
  6. Pongo pygmaeus (Bornean orangutan) ppy-miR-500
  7. Pteropus alecto pal-miR-500-5p
  8. Sus scrofa ssc-miR-500-5p
Publications