v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1714 (LINC01714) URS0000394A79_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01714: LINC01714, a long non-coding RNA, has been shown to suppress tumorigenicity and tumor development in cholangiocytes both in vitro and in vivo [PMC6948235]. Moreover, the overexpression of LINC01714 has been found to enhance the susceptibility of cholangiocarcinoma (CCA) cells to gemcitabine, a chemotherapy drug, by reducing the phosphorylation of FOXO3-Ser318 [PMC9093656]. This suggests that the combination of LINC01714 and gemcitabine chemotherapy may have a synergistic effect on the treatment of advanced CCA patients [PMC9093656]. Further analysis has revealed that LINC01714 specifically inhibits the phosphorylation status of FOXO3 protein [PMC6948235]. This finding suggests that LINC01714 may regulate the activity of FOXO3, a transcription factor involved in cell growth and survival. By inhibiting the phosphorylation of FOXO3, LINC01714 may modulate the downstream signaling pathways regulated by this transcription factor. Overall, these findings highlight the potential therapeutic role of LINC01714 in the treatment of CCA. By suppressing tumorigenicity and enhancing chemotherapy susceptibility through its interaction with FOXO3 signaling pathways, LINC01714 may offer new avenues for targeted therapy in advanced CCA patients.

Targeting miRNAs 1 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAUGUCAAGACUUGGAGUAGGUGACAGUUGGCCUUGGGCUUCGGUGGCCAACCCAUGACUACAAAAGCCCGAGAAGCCAGCAGCUUCCCCGGCUCCUCCACCAAGUGGCCUCUGGGUGAUGGGGAAGCUUGUCCUCUGCUUUGUCACACACAAAACUCUAAAAGUCAGCAUCCCAACGCAUCGGCCUGGAGAGCCCGUCCAGGAGGAUUUAUGUGGAAUCUGGCUUUUCUGAUAGCAUCGACGUUCCUUCCCGUGCCUUCUGAGUCUGUUUCUCUUAAUUUGACUGUGGUCUCUGCUCUUCGCUGGACUCAGUGUUGAACAGGACACUGAAGGACAAGGAGGAACUUAUCCAUGGAGGGGGUAGGGGGAGAUGUCACAAAUUCUGCACCAGAAUCUCACAAAUCACAAAGAACUUACUCAUGUAACGAAACACCACCUGUUUCCCAGUAACUAUGGAAAUAAAAAAAAAUUAAUAAUAAAAAAUUUAAAAAAUAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications